Transcript: Human NM_001322272.2

Homo sapiens cleavage and polyadenylation specific factor 2 (CPSF2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
CPSF2 (53981)
Length:
13226
CDS:
477..2825

Additional Resources:

NCBI RefSeq record:
NM_001322272.2
NBCI Gene record:
CPSF2 (53981)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322272.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075007 CCCTCAGATTCTAGCGTTATA pLKO.1 2475 CDS 100% 13.200 18.480 N CPSF2 n/a
2 TRCN0000075006 CCGGGTTACCTACATAGACTA pLKO.1 2075 CDS 100% 4.950 6.930 N CPSF2 n/a
3 TRCN0000075005 CGGGTTACCTACATAGACTAT pLKO.1 2076 CDS 100% 4.950 6.930 N CPSF2 n/a
4 TRCN0000413700 ATATGATAGGTGGAACAATAT pLKO_005 934 CDS 100% 13.200 9.240 N CPSF2 n/a
5 TRCN0000075003 GCCCTCTTCTTTACTCTTAAT pLKO.1 3984 3UTR 100% 13.200 9.240 N CPSF2 n/a
6 TRCN0000417817 GCTATGACTCTCTCCAGTTTG pLKO_005 3304 3UTR 100% 10.800 7.560 N CPSF2 n/a
7 TRCN0000419365 GTCTGAACTGTGCTATCTATG pLKO_005 712 CDS 100% 10.800 7.560 N CPSF2 n/a
8 TRCN0000428508 GTGTACTTGTTTGCAACAATC pLKO_005 2695 CDS 100% 10.800 7.560 N CPSF2 n/a
9 TRCN0000075004 CCTACTTATCACAGATTCATT pLKO.1 1064 CDS 100% 5.625 3.938 N CPSF2 n/a
10 TRCN0000119561 CTCGACACAATACAGAAGATT pLKO.1 787 CDS 100% 5.625 3.938 N Cpsf2 n/a
11 TRCN0000317837 CTCGACACAATACAGAAGATT pLKO_005 787 CDS 100% 5.625 3.938 N Cpsf2 n/a
12 TRCN0000423591 GGAATGATAAGTGAGAATTAT pLKO_005 3207 3UTR 100% 15.000 9.000 N CPSF2 n/a
13 TRCN0000434454 AGACCAACCTGGGCAACATAG pLKO_005 11018 3UTR 100% 10.800 5.400 Y SULT1A1 n/a
14 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 9065 3UTR 100% 4.950 2.475 Y CFLAR n/a
15 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 9065 3UTR 100% 4.950 2.475 Y C19orf31 n/a
16 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 4169 3UTR 100% 4.950 2.475 Y n/a
17 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 9138 3UTR 100% 4.050 2.025 Y TLCD4 n/a
18 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4242 3UTR 100% 5.625 2.813 Y KLHL30 n/a
19 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 9063 3UTR 100% 4.950 2.475 Y ERN2 n/a
20 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 9063 3UTR 100% 4.950 2.475 Y P3H4 n/a
21 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 9063 3UTR 100% 4.950 2.475 Y P3H4 n/a
22 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4242 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322272.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08358 pDONR223 100% 99.8% 99.7% None (many diffs) n/a
2 ccsbBroad304_08358 pLX_304 0% 99.8% 99.7% V5 (many diffs) n/a
3 TRCN0000476172 CACAGGGTCAACGAGCAAGTATCA pLX_317 16% 99.8% 99.7% V5 (many diffs) n/a
Download CSV