Transcript: Human NM_001323374.2

Homo sapiens calcium/calmodulin dependent protein kinase IV (CAMK4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CAMK4 (814)
Length:
11974
CDS:
133..1554

Additional Resources:

NCBI RefSeq record:
NM_001323374.2
NBCI Gene record:
CAMK4 (814)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226390 TGATCCTGCCAGAGTACTAAA pLKO_005 1535 CDS 100% 13.200 18.480 N CAMK4 n/a
2 TRCN0000009964 CAAAGAAACGGCTGACTACAT pLKO.1 986 CDS 100% 4.950 6.930 N CAMK4 n/a
3 TRCN0000009960 TCGTAAGAACTGAGATAGGAG pLKO.1 386 CDS 100% 2.640 3.696 N CAMK4 n/a
4 TRCN0000196601 GAACTACTGCTTAGCTAATAC pLKO.1 1933 3UTR 100% 13.200 10.560 N CAMK4 n/a
5 TRCN0000217950 TGAACTACTGCTTAGCTAATA pLKO_005 1932 3UTR 100% 13.200 10.560 N CAMK4 n/a
6 TRCN0000009963 GAGGCGATCAGTTCATGTTCA pLKO.1 866 CDS 100% 4.950 3.960 N CAMK4 n/a
7 TRCN0000217998 CATGTGGTCTGTAGGAATAAT pLKO_005 801 CDS 100% 15.000 10.500 N CAMK4 n/a
8 TRCN0000257407 ATGCTGCAGATGCCGTTAAAC pLKO_005 551 CDS 100% 13.200 9.240 N CAMK4 n/a
9 TRCN0000199982 GCAGTGGAGGATGGGATAAAG pLKO.1 1390 CDS 100% 13.200 9.240 N CAMK4 n/a
10 TRCN0000000578 GCCTCTCACATCCAAACATTA pLKO.1 416 CDS 100% 13.200 9.240 N CAMK4 n/a
11 TRCN0000226389 ATCCGTGGGTCACAGGTAAAG pLKO_005 1022 CDS 100% 10.800 7.560 N CAMK4 n/a
12 TRCN0000196662 GAGAACTGTTTGATAGGATTG pLKO.1 503 CDS 100% 6.000 4.200 N CAMK4 n/a
13 TRCN0000000579 AGAAAGTTAAAGGTGCAGATA pLKO.1 1334 CDS 100% 4.950 3.465 N CAMK4 n/a
14 TRCN0000000581 CAACGAGGACATGAAAGCTAT pLKO.1 1227 CDS 100% 4.950 3.465 N CAMK4 n/a
15 TRCN0000000577 GATACCTAATACCGATGAGTT pLKO.1 1758 3UTR 100% 4.950 3.465 N CAMK4 n/a
16 TRCN0000009962 GATATTACAGTGAGCGAGATG pLKO.1 533 CDS 100% 4.050 2.835 N CAMK4 n/a
17 TRCN0000000580 GTCACAGGTAAAGCAGCCAAT pLKO.1 1030 CDS 100% 4.050 2.835 N CAMK4 n/a
18 TRCN0000009961 TGGTCCTAGAACTCGTCACAG pLKO.1 479 CDS 100% 4.050 2.835 N CAMK4 n/a
19 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3590 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000480036 CACTTAGCGCAATCTTGCATAACG pLX_317 24.6% 99.9% 100% V5 1011G>C n/a
2 ccsbBroadEn_05929 pDONR223 100% 99.8% 99.7% None 1011G>C;1411C>N n/a
3 ccsbBroad304_05929 pLX_304 0% 99.8% 99.7% V5 1011G>C;1411C>N n/a
4 ccsbBroadEn_14561 pDONR223 0% 99.9% 100% None 1011G>C n/a
5 ccsbBroad304_14561 pLX_304 0% 99.9% 100% V5 1011G>C n/a
6 TRCN0000480966 CAAAGATTTTAGCGCCCGCTTTCG pLX_317 29.4% 99.8% 99.3% V5 (not translated due to frame shift) 1011G>C;1411delC n/a
7 TRCN0000488719 GAACGTGCGGTGTATCGCACCCCG pLX_317 19.9% 99.6% 99.5% V5 (not translated due to prior stop codon) 1011G>C;1289T>A;1419_1420insTTG n/a
Download CSV