Transcript: Human NM_001323911.2

Homo sapiens GA binding protein transcription factor subunit beta 2 (GABPB2), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
GABPB2 (126626)
Length:
2646
CDS:
175..1419

Additional Resources:

NCBI RefSeq record:
NM_001323911.2
NBCI Gene record:
GABPB2 (126626)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431255 ATCGAGATGTCGTAGAGTTAC pLKO_005 521 CDS 100% 10.800 15.120 N GABPB2 n/a
2 TRCN0000428565 TTAACCTCGCAAGCCTTATTT pLKO_005 749 CDS 100% 15.000 12.000 N GABPB2 n/a
3 TRCN0000005661 GCAGCCCAATGGAGTTGATTT pLKO.1 1245 CDS 100% 13.200 9.240 N GABPB2 n/a
4 TRCN0000435840 GAGAAGTTGCCACTAACAAAG pLKO_005 1042 CDS 100% 10.800 7.560 N GABPB2 n/a
5 TRCN0000010959 GCAATGCAGAATCAGGTGAAT pLKO.1 649 CDS 100% 4.950 3.465 N GABPB2 n/a
6 TRCN0000005659 GCCAAGATGATGAAGTGAGAA pLKO.1 224 CDS 100% 4.950 3.465 N GABPB2 n/a
7 TRCN0000438667 CATCGTGGAACTGCTTGTTAG pLKO_005 429 CDS 100% 10.800 8.640 N Gabpb2 n/a
8 TRCN0000055014 GCCAGCCATTTATTGTAACTA pLKO.1 944 CDS 100% 5.625 3.938 N Gabpb2 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1508 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1508 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04817 pDONR223 100% 84.5% 82.8% None (many diffs) n/a
2 ccsbBroad304_04817 pLX_304 0% 84.5% 82.8% V5 (many diffs) n/a
3 TRCN0000467065 CAGCGACGATACGTCTCCGCGCAG pLX_317 30.4% 84.5% 82.8% V5 (many diffs) n/a
4 ccsbBroadEn_11616 pDONR223 100% 8.7% 3.3% None (many diffs) n/a
5 ccsbBroad304_11616 pLX_304 0% 8.7% 3.3% V5 (many diffs) n/a
6 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 8.7% 3.3% V5 (many diffs) n/a
Download CSV