Transcript: Human NM_001324002.1

Homo sapiens catenin alpha 1 (CTNNA1), transcript variant 26, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
CTNNA1 (1495)
Length:
3184
CDS:
558..1973

Additional Resources:

NCBI RefSeq record:
NM_001324002.1
NBCI Gene record:
CTNNA1 (1495)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324002.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234534 CCCTCTGTCCTCAGGTTATTA pLKO_005 823 CDS 100% 15.000 10.500 N CTNNA1 n/a
2 TRCN0000234535 CAGTGTCTCGATGCCATAATC pLKO_005 2863 3UTR 100% 13.200 9.240 N CTNNA1 n/a
3 TRCN0000062653 CCACATTAGCTTGTTAGTAAT pLKO.1 2497 3UTR 100% 13.200 7.920 N CTNNA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324002.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10759 pDONR223 100% 84.7% 83.3% None (many diffs) n/a
2 ccsbBroad304_10759 pLX_304 0% 84.7% 83.3% V5 (many diffs) n/a
3 TRCN0000469946 TCGTTAACGTGATGTTACGGGCCT pLX_317 29.4% 84.7% 83.3% V5 (many diffs) n/a
Download CSV