Transcript: Human NM_001324371.2

Homo sapiens acyl-CoA synthetase medium chain family member 5 (ACSM5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ACSM5 (54988)
Length:
2792
CDS:
144..1883

Additional Resources:

NCBI RefSeq record:
NM_001324371.2
NBCI Gene record:
ACSM5 (54988)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156464 CCAGTCTGAAACGGTTGTCAT pLKO.1 1256 CDS 100% 4.950 3.465 N ACSM5 n/a
2 TRCN0000157455 GACAGAGAAGGACCTCAAGTA pLKO.1 590 CDS 100% 4.950 3.465 N ACSM5 n/a
3 TRCN0000154841 GATGTGCAGATTGTGGATGAT pLKO.1 1341 CDS 100% 4.950 3.465 N ACSM5 n/a
4 TRCN0000157454 GCCAAAGACGGTTTCTGGAAA pLKO.1 1820 CDS 100% 4.950 3.465 N ACSM5 n/a
5 TRCN0000154584 GCTTTCAGATTTCCCTCCATA pLKO.1 2168 3UTR 100% 4.950 3.465 N ACSM5 n/a
6 TRCN0000157075 GCATCATCTCTTCGACCCTAA pLKO.1 1963 3UTR 100% 4.050 2.835 N ACSM5 n/a
7 TRCN0000158310 CCAGTGGGAATGTAAAGGCTT pLKO.1 2236 3UTR 100% 2.640 1.848 N ACSM5 n/a
8 TRCN0000155808 CAATTCTTCAAGCTACCGGAT pLKO.1 1568 CDS 100% 2.160 1.512 N ACSM5 n/a
9 TRCN0000155464 GAGAGGTGGTAAAGGCATTTA pLKO.1 1675 CDS 100% 13.200 7.920 N ACSM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08442 pDONR223 100% 99.9% 99.8% None 1505T>C n/a
2 ccsbBroad304_08442 pLX_304 0% 99.9% 99.8% V5 1505T>C n/a
3 TRCN0000469405 CTCCTATAGCGATTTTCTCCCCGC pLX_317 22.4% 99.9% 99.8% V5 1505T>C n/a
4 ccsbBroadEn_12130 pDONR223 100% 35.9% 35.9% None 625_1737del n/a
5 ccsbBroad304_12130 pLX_304 0% 35.9% 35.9% V5 625_1737del n/a
6 TRCN0000473174 GTCGGAGTGGGTCTACGAGCGTTG pLX_317 62.7% 35.9% 35.9% V5 625_1737del n/a
7 ccsbBroadEn_15878 pDONR223 0% 35.8% 35.7% None 424A>G;625_1737del n/a
8 ccsbBroad304_15878 pLX_304 0% 35.8% 35.7% V5 424A>G;625_1737del n/a
9 TRCN0000469072 GGCTTATCCCGCCATCTCTTTTCG pLX_317 70.8% 35.8% 35.7% V5 424A>G;625_1737del n/a
Download CSV