Transcript: Human NM_001329493.1

Homo sapiens ER membrane protein complex subunit 2 (EMC2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
EMC2 (9694)
Length:
3587
CDS:
77..997

Additional Resources:

NCBI RefSeq record:
NM_001329493.1
NBCI Gene record:
EMC2 (9694)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329493.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125566 CGGGATGACTTGGCATTGTTT pLKO.1 305 CDS 100% 5.625 7.875 N Emc2 n/a
2 TRCN0000147221 GAACTTATTGGCCTGTAACTT pLKO.1 1042 3UTR 100% 5.625 7.875 N EMC2 n/a
3 TRCN0000319124 GAACTTATTGGCCTGTAACTT pLKO_005 1042 3UTR 100% 5.625 7.875 N EMC2 n/a
4 TRCN0000275462 GATGATGCTATACAGCTATAT pLKO_005 413 CDS 100% 13.200 9.240 N EMC2 n/a
5 TRCN0000125567 GCAAGTCATATTGCTTCTAAT pLKO.1 809 CDS 100% 13.200 9.240 N Emc2 n/a
6 TRCN0000128157 CTGTTAAGAAGGCAGTTGTAA pLKO.1 1106 3UTR 100% 5.625 3.938 N EMC2 n/a
7 TRCN0000128779 CGGCAAGTCATATTGCTTCTA pLKO.1 807 CDS 100% 4.950 3.465 N EMC2 n/a
8 TRCN0000349619 CGGCAAGTCATATTGCTTCTA pLKO_005 807 CDS 100% 4.950 3.465 N EMC2 n/a
9 TRCN0000149003 GCGATTAACAGGCATGAGATT pLKO.1 373 CDS 100% 4.950 3.465 N EMC2 n/a
10 TRCN0000275405 GCGATTAACAGGCATGAGATT pLKO_005 373 CDS 100% 4.950 3.465 N EMC2 n/a
11 TRCN0000147739 CAAATTGTGGAAGTTGGAGAA pLKO.1 170 CDS 100% 4.050 2.835 N EMC2 n/a
12 TRCN0000130060 GCTAGTCAAATAAACAGAGCT pLKO.1 884 CDS 100% 2.640 1.848 N EMC2 n/a
13 TRCN0000313696 GCATGAACTTGCAGAACTTTA pLKO_005 577 CDS 100% 13.200 7.920 N Emc2 n/a
14 TRCN0000275461 CAGTTTGCAGGTCGAAGTAAG pLKO_005 908 CDS 100% 10.800 6.480 N EMC2 n/a
15 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 2709 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
16 TRCN0000186429 CTTGGGAAGAAATGAGAGAAT pLKO.1 108 CDS 100% 4.950 2.970 N SSU72P8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329493.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02228 pDONR223 100% 97% 97% None 155_181del n/a
2 ccsbBroad304_02228 pLX_304 0% 97% 97% V5 155_181del n/a
3 TRCN0000476617 CTGTATGCATCGAATTCGATGCCT pLX_317 47.3% 97% 97% V5 155_181del n/a
4 ccsbBroadEn_07468 pDONR223 100% 96.9% 96.7% None 155_181del;461A>G n/a
5 ccsbBroad304_07468 pLX_304 0% 96.9% 96.7% V5 155_181del;461A>G n/a
6 TRCN0000481071 TAAGTAAGGCCAAAGGGGCGTGGT pLX_317 50.4% 96.9% 96.7% V5 155_181del;461A>G n/a
Download CSV