Transcript: Human NM_001329917.2

Homo sapiens partner of NOB1 homolog (PNO1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PNO1 (56902)
Length:
1604
CDS:
48..689

Additional Resources:

NCBI RefSeq record:
NM_001329917.2
NBCI Gene record:
PNO1 (56902)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330085 CCTAAAGGGAGACCATCTATC pLKO_005 557 CDS 100% 10.800 8.640 N PNO1 n/a
2 TRCN0000217505 GGGACTTCAGATACGCTTTAA pLKO.1 356 CDS 100% 13.200 9.240 N Pno1 n/a
3 TRCN0000330156 GGGACTTCAGATACGCTTTAA pLKO_005 356 CDS 100% 13.200 9.240 N PNO1 n/a
4 TRCN0000330157 TGAAGATATTTACTCCTATTG pLKO_005 325 CDS 100% 10.800 7.560 N PNO1 n/a
5 TRCN0000072357 GATACACACCATTGAAAGAAA pLKO.1 298 CDS 100% 5.625 3.938 N PNO1 n/a
6 TRCN0000072354 AGGATGTTAGTGCTCTGACAA pLKO.1 421 CDS 100% 4.950 3.465 N PNO1 n/a
7 TRCN0000072355 AGACCATCTATCCAGGGCAAT pLKO.1 566 CDS 100% 4.050 2.835 N PNO1 n/a
8 TRCN0000329006 TGGGACTTCAGATACGCTTTA pLKO_005 355 CDS 100% 10.800 6.480 N Pno1 n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 832 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 832 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1179 3UTR 100% 10.800 5.400 Y SMIM11A n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 830 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 830 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 830 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03752 pDONR223 100% 83.9% 83.7% None (many diffs) n/a
2 ccsbBroad304_03752 pLX_304 0% 83.9% 83.7% V5 (many diffs) n/a
3 TRCN0000474613 CGTCCGTAGTGTATGAGATGCTTT pLX_317 72.2% 83.9% 83.7% V5 (many diffs) n/a
Download CSV