Transcript: Human NM_001347425.1

Homo sapiens alpha-2-macroglobulin (A2M), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
A2M (2)
Length:
4785
CDS:
671..4645

Additional Resources:

NCBI RefSeq record:
NM_001347425.1
NBCI Gene record:
A2M (2)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006657 CCTTTGAATGACCAGGACGAT pLKO.1 2117 CDS 100% 2.640 3.696 N A2M n/a
2 TRCN0000356254 AGGCGTCCCTATACCAAATAA pLKO_005 1345 CDS 100% 15.000 12.000 N A2M n/a
3 TRCN0000356192 AGACTGCATCAATCGTCATAA pLKO_005 2140 CDS 100% 13.200 9.240 N A2M n/a
4 TRCN0000080506 CCTCCAGACATCCTTGAAATA pLKO.1 4189 CDS 100% 13.200 9.240 N A2m n/a
5 TRCN0000356250 CTCTTACTGTTAGGGTCAATT pLKO_005 1473 CDS 100% 13.200 9.240 N A2M n/a
6 TRCN0000356251 ACCAACTCAAAGATTCGTAAA pLKO_005 2255 CDS 100% 10.800 7.560 N A2M n/a
7 TRCN0000006655 CCAGGCACATTATATTCTGAA pLKO.1 1648 CDS 100% 4.950 3.465 N A2M n/a
8 TRCN0000006653 CCCAAGTTTGAAGTACAAGTA pLKO.1 899 CDS 100% 4.950 3.465 N A2M n/a
9 TRCN0000006656 CCTAACATCTATGTACTGGAT pLKO.1 3164 CDS 100% 2.640 1.848 N A2M n/a
10 TRCN0000006654 CCATAGTGAAAGTCTATGATT pLKO.1 4554 CDS 100% 0.563 0.394 N A2M n/a
11 TRCN0000356252 AGTGACCCTCTCCGCCTATAT pLKO_005 3514 CDS 100% 13.200 7.920 N A2M n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05749 pDONR223 100% 89.8% 89.7% None 0_1ins450;2548A>G n/a
2 ccsbBroad304_05749 pLX_304 0% 89.8% 89.7% V5 0_1ins450;2548A>G n/a
3 TRCN0000479287 GTCGAGGGACCAGTTCTTAGTAGA pLX_317 7.7% 89.8% 89.7% V5 0_1ins450;2548A>G n/a
Download CSV