Transcript: Mouse NM_001347585.1

Mus musculus SH3-domain binding protein 5 (BTK-associated) (Sh3bp5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Sh3bp5 (24056)
Length:
3822
CDS:
64..1434

Additional Resources:

NCBI RefSeq record:
NM_001347585.1
NBCI Gene record:
Sh3bp5 (24056)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347585.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190447 GCAACGGTGAAACTAGACGAA pLKO.1 304 CDS 100% 2.640 3.696 N Sh3bp5 n/a
2 TRCN0000240725 ACCGACGAGTCCGTCTGAAAT pLKO_005 1047 CDS 100% 13.200 10.560 N Sh3bp5 n/a
3 TRCN0000122325 CATCAACAAGTCCAAGCCTTA pLKO.1 678 CDS 100% 4.050 3.240 N SH3BP5 n/a
4 TRCN0000240722 GCCTATGTGCAGATCATATTT pLKO_005 1452 3UTR 100% 15.000 10.500 N Sh3bp5 n/a
5 TRCN0000240726 ATGGAATTATTGCTGACATAA pLKO_005 1394 CDS 100% 13.200 9.240 N Sh3bp5 n/a
6 TRCN0000217689 GTTTATGCTGCACCTAGTATT pLKO.1 2263 3UTR 100% 13.200 9.240 N Sh3bp5 n/a
7 TRCN0000240723 AGGATGACAAGCGGCAGTTTG pLKO_005 500 CDS 100% 10.800 7.560 N Sh3bp5 n/a
8 TRCN0000240724 CCCAGTCTGTGTCCAGCTTTA pLKO_005 1019 CDS 100% 10.800 7.560 N Sh3bp5 n/a
9 TRCN0000192876 GAGTGACAAAGCCAACAACAA pLKO.1 1248 CDS 100% 4.950 3.465 N Sh3bp5 n/a
10 TRCN0000190910 CCATCAACAAGTCCAAGCCTT pLKO.1 677 CDS 100% 2.640 1.848 N Sh3bp5 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1869 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347585.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14020 pDONR223 100% 79.2% 77.7% None (many diffs) n/a
2 ccsbBroad304_14020 pLX_304 0% 79.2% 77.7% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000465450 CCGAAAGCAACTTGTTGGTTTCAC pLX_317 32.5% 79.2% 77.7% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_14941 pDONR223 0% 79.2% 77.7% None (many diffs) n/a
5 ccsbBroad304_14941 pLX_304 0% 79.2% 77.7% V5 (many diffs) n/a
6 TRCN0000473064 CATTCACGTCCACACCCTGCCGCC pLX_317 27.7% 79.2% 77.7% V5 (many diffs) n/a
Download CSV