Transcript: Human NM_001349216.2

Homo sapiens ariadne RBR E3 ubiquitin protein ligase 2 (ARIH2), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ARIH2 (10425)
Length:
5027
CDS:
581..1915

Additional Resources:

NCBI RefSeq record:
NM_001349216.2
NBCI Gene record:
ARIH2 (10425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294442 AGCCCTCAAGAAGTACTTATT pLKO_005 1513 CDS 100% 13.200 18.480 N ARIH2 n/a
2 TRCN0000034272 GCTGGATGTGTCTAGGAGATT pLKO.1 1401 CDS 100% 4.950 6.930 N ARIH2 n/a
3 TRCN0000298272 GCTGGATGTGTCTAGGAGATT pLKO_005 1401 CDS 100% 4.950 6.930 N ARIH2 n/a
4 TRCN0000034269 CCTCCCAAATAAATTTGCTTT pLKO.1 2789 3UTR 100% 4.950 3.960 N ARIH2 n/a
5 TRCN0000034271 CGACTCTGAAACAGCCAACTA pLKO.1 1210 CDS 100% 4.950 3.960 N ARIH2 n/a
6 TRCN0000294396 GCAACACCTCTTAGTTGATTT pLKO_005 2046 3UTR 100% 13.200 9.240 N ARIH2 n/a
7 TRCN0000034270 CCTGCAATACACCTACCCATA pLKO.1 1702 CDS 100% 4.050 2.835 N ARIH2 n/a
8 TRCN0000034273 GAGGACTATTACGTGGGAGTA pLKO.1 424 5UTR 100% 4.050 2.835 N ARIH2 n/a
9 TRCN0000294440 CTGTGCCACAATCCGGAAATG pLKO_005 1171 CDS 100% 10.800 6.480 N ARIH2 n/a
10 TRCN0000041024 CCCAGGAAGAAGCTGTTTGAA pLKO.1 1745 CDS 100% 5.625 3.375 N Arih2 n/a
11 TRCN0000316889 CCCAGGAAGAAGCTGTTTGAA pLKO_005 1745 CDS 100% 5.625 3.375 N Arih2 n/a
12 TRCN0000041026 CCAATGAAGAATTGAGAGATA pLKO.1 969 CDS 100% 4.950 2.970 N Arih2 n/a
13 TRCN0000316887 CCAATGAAGAATTGAGAGATA pLKO_005 969 CDS 100% 4.950 2.970 N Arih2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02426 pDONR223 100% 80.1% 78.8% None (many diffs) n/a
2 ccsbBroad304_02426 pLX_304 0% 80.1% 78.8% V5 (many diffs) n/a
3 TRCN0000479033 TCAACTACTTGACCCAAAAACTCC pLX_317 25.9% 80.1% 78.8% V5 (many diffs) n/a
Download CSV