Transcript: Human NM_001349437.1

Homo sapiens apolipoprotein B mRNA editing enzyme catalytic subunit 3G (APOBEC3G), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
APOBEC3G (60489)
Length:
1680
CDS:
405..1358

Additional Resources:

NCBI RefSeq record:
NM_001349437.1
NBCI Gene record:
APOBEC3G (60489)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418047 ATTAGAGTGCATTACTTTGAA pLKO_005 1519 3UTR 100% 5.625 7.875 N APOBEC3G n/a
2 TRCN0000052190 GCCCGCATCTATGATGATCAA pLKO.1 1137 CDS 100% 4.950 6.930 N APOBEC3G n/a
3 TRCN0000052189 CCACATAAACACGGTTTCCTT pLKO.1 942 CDS 100% 3.000 4.200 N APOBEC3G n/a
4 TRCN0000052191 CCTTGGAATAATCTGCCTAAA pLKO.1 723 CDS 100% 10.800 7.560 N APOBEC3G n/a
5 TRCN0000440501 TGCATCGTGACCAGGAGTATG pLKO_005 442 CDS 100% 10.800 7.560 N APOBEC3G n/a
6 TRCN0000425724 ATTGTGCTCAATACACAGAAA pLKO_005 1578 3UTR 100% 4.950 3.465 N APOBEC3G n/a
7 TRCN0000052192 GCATGAGACTTACCTGTGTTA pLKO.1 848 CDS 100% 4.950 3.465 N APOBEC3G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03889 pDONR223 100% 82.5% 82.5% None 0_1ins201 n/a
2 ccsbBroad304_03889 pLX_304 0% 82.5% 82.5% V5 0_1ins201 n/a
3 TRCN0000479742 GTTCGGCCGCCCCACCAAATAGGT pLX_317 26.7% 82.5% 82.5% V5 0_1ins201 n/a
Download CSV