Transcript: Human NM_001350490.1

Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like (MTHFD1L), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
MTHFD1L (25902)
Length:
2016
CDS:
811..1623

Additional Resources:

NCBI RefSeq record:
NM_001350490.1
NBCI Gene record:
MTHFD1L (25902)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350490.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229790 TCTGTGGAGTTTCCATTATTT pLKO_005 1860 3UTR 100% 15.000 10.500 N MTHFD1L n/a
2 TRCN0000229789 ACCGAAACAGAACAAGTTAAA pLKO_005 1591 CDS 100% 13.200 9.240 N MTHFD1L n/a
3 TRCN0000045401 CGATTCCAGTTCCTGTATGAT pLKO.1 1246 CDS 100% 5.625 3.938 N MTHFD1L n/a
4 TRCN0000229788 GTGAGAGAGGCTGCGAGTAAA pLKO_005 1219 CDS 100% 13.200 7.920 N MTHFD1L n/a
5 TRCN0000036591 GCTGTCTATGGAGCCAAAGAT pLKO.1 1309 CDS 100% 5.625 2.813 Y LOC389737 n/a
6 TRCN0000036590 GTGGACAAGATAAGGACCATT pLKO.1 1282 CDS 100% 4.950 2.475 Y LOC389737 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350490.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14097 pDONR223 100% 73.4% 73.2% None 1_1delAins289;214A>G;372C>G n/a
2 ccsbBroad304_14097 pLX_304 0% 73.4% 73.2% V5 1_1delAins289;214A>G;372C>G n/a
3 TRCN0000481112 TAATGATCTATAGGGTACTATCCT pLX_317 43.6% 73.4% 73.2% V5 1_1delAins289;214A>G;372C>G n/a
4 ccsbBroadEn_11782 pDONR223 100% 36.7% 36.6% None 1_1delAins1390;372C>G n/a
5 ccsbBroad304_11782 pLX_304 0% 36.7% 36.6% V5 1_1delAins1390;372C>G n/a
6 TRCN0000472684 TAAATGCATCCAACAAAAACATAA pLX_317 20.9% 36.7% 36.6% V5 1_1delAins1390;372C>G n/a
Download CSV