Transcript: Human NM_001351366.2

Homo sapiens RIC8 guanine nucleotide exchange factor B (RIC8B), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RIC8B (55188)
Length:
5043
CDS:
324..1742

Additional Resources:

NCBI RefSeq record:
NM_001351366.2
NBCI Gene record:
RIC8B (55188)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230248 CTGCGACTAGCCAAGCTAAAT pLKO_005 336 CDS 100% 13.200 18.480 N RIC8B n/a
2 TRCN0000230249 GAATCGGCCATAGACCATAAT pLKO_005 684 CDS 100% 13.200 18.480 N RIC8B n/a
3 TRCN0000230250 TTCTCATCAGTTCCGTGTAAT pLKO_005 806 CDS 100% 13.200 18.480 N RIC8B n/a
4 TRCN0000219033 GATGAACTGCCCAGTAATAAA pLKO_005 996 CDS 100% 15.000 10.500 N RIC8B n/a
5 TRCN0000257144 TTAAATCCAGAACGCTTTATA pLKO_005 3601 3UTR 100% 15.000 10.500 N RIC8B n/a
6 TRCN0000006464 CCAGTTATTGTGGAGTCATTA pLKO.1 393 CDS 100% 13.200 9.240 N RIC8B n/a
7 TRCN0000436180 GCTTAAACCAATGGGACTAAA pLKO_005 1640 CDS 100% 13.200 9.240 N Ric8b n/a
8 TRCN0000420175 CATTAACTGGTTTACTCATTG pLKO_005 1851 3UTR 100% 10.800 7.560 N Ric8b n/a
9 TRCN0000006463 CCTCAGACTTACAAACTGATT pLKO.1 2290 3UTR 100% 4.950 3.465 N RIC8B n/a
10 TRCN0000006466 GCTCTCTTCAATGTGACGGTA pLKO.1 756 CDS 100% 2.640 1.848 N RIC8B n/a
11 TRCN0000418668 ACTTGTCAACATGCTTGATAA pLKO_005 1601 CDS 100% 13.200 7.920 N Ric8b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12180 pDONR223 100% 84.7% 84.6% None (many diffs) n/a
2 ccsbBroad304_12180 pLX_304 0% 84.7% 84.6% V5 (many diffs) n/a
3 TRCN0000477167 ACGTCCTACCCTAAGCCCTGGAGT pLX_317 19.1% 84.7% 84.6% V5 (many diffs) n/a
Download CSV