Transcript: Human NM_001351585.2

Homo sapiens outer dense fiber of sperm tails 2 (ODF2), transcript variant 20, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ODF2 (4957)
Length:
3993
CDS:
482..2956

Additional Resources:

NCBI RefSeq record:
NM_001351585.2
NBCI Gene record:
ODF2 (4957)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351585.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140177 GAATGCGGTTGGTTGTCTGAA pLKO.1 859 CDS 100% 4.950 6.930 N ODF2 n/a
2 TRCN0000247772 CCTTACATGTTCACGTGGATG pLKO_005 507 CDS 100% 4.050 5.670 N Odf2 n/a
3 TRCN0000140822 GACTGCTGAGTATTCCGCATT pLKO.1 1957 CDS 100% 4.050 5.670 N ODF2 n/a
4 TRCN0000280592 GACTGCTGAGTATTCCGCATT pLKO_005 1957 CDS 100% 4.050 5.670 N ODF2 n/a
5 TRCN0000247773 GTGGGAGAATCCACCTCATTG pLKO_005 709 CDS 100% 10.800 7.560 N Odf2 n/a
6 TRCN0000139291 CCGAGACAAAGAGAGCTTGAA pLKO.1 1654 CDS 100% 4.950 3.465 N ODF2 n/a
7 TRCN0000280593 CCGAGACAAAGAGAGCTTGAA pLKO_005 1654 CDS 100% 4.950 3.465 N ODF2 n/a
8 TRCN0000145303 CTTCAGAAGAAACACCTACAA pLKO.1 1049 CDS 100% 4.950 3.465 N ODF2 n/a
9 TRCN0000280594 CTTCAGAAGAAACACCTACAA pLKO_005 1049 CDS 100% 4.950 3.465 N ODF2 n/a
10 TRCN0000121634 GAAAGACTAATGGAGCAACAA pLKO.1 1316 CDS 100% 4.950 3.465 N ODF2 n/a
11 TRCN0000144392 CAACTATAAGAGTCAGGTGAT pLKO.1 2098 CDS 100% 4.050 2.835 N ODF2 n/a
12 TRCN0000142762 CAAGTTTCTTTGAGGCCACTT pLKO.1 3470 3UTR 100% 4.050 2.835 N ODF2 n/a
13 TRCN0000140628 GCTTGTGTCCATTTGGCCTTT pLKO.1 3523 3UTR 100% 4.050 2.835 N ODF2 n/a
14 TRCN0000138961 CCATGACTTTGCTCCTTCCTT pLKO.1 3236 3UTR 100% 3.000 1.800 N ODF2 n/a
15 TRCN0000280656 CCATGACTTTGCTCCTTCCTT pLKO_005 3236 3UTR 100% 3.000 1.800 N ODF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351585.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11008 pDONR223 100% 92.5% 92.5% None 1_126del;176_232del;696A>G n/a
2 ccsbBroad304_11008 pLX_304 0% 92.5% 92.5% V5 1_126del;176_232del;696A>G n/a
3 TRCN0000465232 CTCGCCGGGAATAAGATTTCCTCC pLX_317 14.7% 92.5% 92.5% V5 1_126del;176_232del;696A>G n/a
Download CSV