Transcript: Human NM_001353226.2

Homo sapiens tripartite motif containing 16 like (TRIM16L), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TRIM16L (147166)
Length:
845
CDS:
394..642

Additional Resources:

NCBI RefSeq record:
NM_001353226.2
NBCI Gene record:
TRIM16L (147166)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160434 CAGTTTCCTCATCTGTAAATA pLKO.1 289 5UTR 100% 15.000 7.500 Y YIF1B n/a
2 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 660 3UTR 100% 5.625 2.813 Y KLHL30 n/a
3 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 660 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12783 pDONR223 100% 74.8% 5% None (many diffs) n/a
2 ccsbBroad304_12783 pLX_304 0% 74.8% 5% V5 (many diffs) n/a
3 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 74.8% 5% V5 (many diffs) n/a
4 ccsbBroadEn_13766 pDONR223 100% 47.1% 8.3% None (many diffs) n/a
5 ccsbBroad304_13766 pLX_304 0% 47.1% 8.3% V5 (many diffs) n/a
6 TRCN0000474083 TCTCGACACAAACAGACTTCAACG pLX_317 100% 47.1% 8.3% V5 (many diffs) n/a
7 ccsbBroadEn_10246 pDONR223 100% 36.6% 15.3% None (many diffs) n/a
8 ccsbBroad304_10246 pLX_304 0% 36.6% 15.3% V5 (many diffs) n/a
9 TRCN0000467526 TATTTATATAAACTTACCCCCACA pLX_317 63.9% 36.6% 15.3% V5 (many diffs) n/a
Download CSV