Transcript: Human NM_001353346.3

Homo sapiens enolase 1 (ENO1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ENO1 (2023)
Length:
1781
CDS:
117..1421

Additional Resources:

NCBI RefSeq record:
NM_001353346.3
NBCI Gene record:
ENO1 (2023)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353346.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029327 CGTGAACGAGAAGTCCTGCAA pLKO.1 1109 CDS 100% 2.640 2.112 N ENO1 n/a
2 TRCN0000293240 CGTGAACGAGAAGTCCTGCAA pLKO_005 1109 CDS 100% 2.640 2.112 N ENO1 n/a
3 TRCN0000272010 CGCATTGGAGCAGAGGTTTAC pLKO_005 663 CDS 100% 10.800 7.560 N Gm4735 n/a
4 TRCN0000029324 CGTACCGCTTCCTTAGAACTT pLKO.1 1557 3UTR 100% 4.950 3.465 N ENO1 n/a
5 TRCN0000293182 CGTACCGCTTCCTTAGAACTT pLKO_005 1557 3UTR 100% 4.950 3.465 N ENO1 n/a
6 TRCN0000029325 CCGGCGTTCAATGTCATCAAT pLKO.1 558 CDS 100% 5.625 3.375 N ENO1 n/a
7 TRCN0000029326 GAATGTCATCAAGGAGAAATA pLKO.1 695 CDS 100% 13.200 6.600 Y ENO1 n/a
8 TRCN0000298462 GAATGTCATCAAGGAGAAATA pLKO_005 695 CDS 100% 13.200 6.600 Y ENO1 n/a
9 TRCN0000029328 CCACTGTTGAGGTTGATCTCT pLKO.1 169 CDS 100% 3.000 1.500 Y ENO1 n/a
10 TRCN0000293239 CCACTGTTGAGGTTGATCTCT pLKO_005 169 CDS 100% 3.000 1.500 Y ENO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353346.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06160 pDONR223 100% 97.6% 97.2% None (many diffs) n/a
2 ccsbBroad304_06160 pLX_304 0% 97.6% 97.2% V5 (many diffs) n/a
3 TRCN0000473656 GCTCTCATAGGGCATGCCCCCTCG pLX_317 41.9% 97.6% 97.2% V5 (many diffs) n/a
4 ccsbBroadEn_13136 pDONR223 100% 80.7% 77.4% None (many diffs) n/a
5 ccsbBroad304_13136 pLX_304 0% 80.7% 77.4% V5 (many diffs) n/a
Download CSV