Transcript: Human NM_001353782.2

Homo sapiens clathrin heavy chain linker domain containing 1 (CLHC1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CLHC1 (130162)
Length:
5353
CDS:
770..2110

Additional Resources:

NCBI RefSeq record:
NM_001353782.2
NBCI Gene record:
CLHC1 (130162)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434418 TAAGCTAATGTCCAGATATAT pLKO_005 2387 3UTR 100% 15.000 21.000 N CLHC1 n/a
2 TRCN0000139245 CGATGACCTGTTGCAGCTATT pLKO.1 1732 CDS 100% 10.800 15.120 N CLHC1 n/a
3 TRCN0000142549 GTTATGCAGCAAACAGTCCTA pLKO.1 1293 CDS 100% 2.640 3.696 N CLHC1 n/a
4 TRCN0000412247 GTGGCAAGAAGTGGCAAATAT pLKO_005 1963 CDS 100% 15.000 10.500 N CLHC1 n/a
5 TRCN0000434224 TCTAGATGCTCTCACTAAATA pLKO_005 874 CDS 100% 15.000 10.500 N CLHC1 n/a
6 TRCN0000426149 CAAGACTTTGTGGAGCAAATT pLKO_005 1121 CDS 100% 13.200 9.240 N CLHC1 n/a
7 TRCN0000141813 GATGACCTGTTGCAGCTATTA pLKO.1 1733 CDS 100% 13.200 9.240 N CLHC1 n/a
8 TRCN0000414447 GAGCTTGTACAACACCTTATG pLKO_005 2134 3UTR 100% 10.800 7.560 N CLHC1 n/a
9 TRCN0000419069 GTGAAACAGTGTAGGGCATTT pLKO_005 2353 3UTR 100% 10.800 7.560 N CLHC1 n/a
10 TRCN0000145093 GAAAGACCGAAGAACTACATT pLKO.1 741 5UTR 100% 5.625 3.938 N CLHC1 n/a
11 TRCN0000145260 GAGCATATCACTGCATACAAA pLKO.1 667 5UTR 100% 5.625 3.938 N CLHC1 n/a
12 TRCN0000139388 CAGAGCCTACAGCTTTGGTAT pLKO.1 794 CDS 100% 4.950 3.465 N CLHC1 n/a
13 TRCN0000142149 GCAGTCAACCTAATGGAACAT pLKO.1 2078 CDS 100% 4.950 3.465 N CLHC1 n/a
14 TRCN0000139244 CAGGCACTTAGTTCATGGGTA pLKO.1 1076 CDS 100% 2.640 1.848 N CLHC1 n/a
15 TRCN0000426470 AGGAATCAAATGTGGATTATC pLKO_005 1465 CDS 100% 13.200 7.920 N CLHC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09524 pDONR223 100% 92.2% 90.7% None (many diffs) n/a
2 ccsbBroad304_09524 pLX_304 0% 92.2% 90.7% V5 (many diffs) n/a
3 TRCN0000467092 TCATCAATTAGCTCTATATGTTCT pLX_317 30% 92.2% 90.7% V5 (many diffs) n/a
4 ccsbBroadEn_09525 pDONR223 100% 75.9% 71.8% None (many diffs) n/a
5 ccsbBroad304_09525 pLX_304 0% 75.9% 71.8% V5 (many diffs) n/a
6 TRCN0000469820 GTCACCCCCAACTTTTGTCCGTTA pLX_317 25.3% 75.9% 71.8% V5 (many diffs) n/a
Download CSV