Transcript: Human NM_001353970.1

Homo sapiens STAM binding protein (STAMBP), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
STAMBP (10617)
Length:
6462
CDS:
223..1455

Additional Resources:

NCBI RefSeq record:
NM_001353970.1
NBCI Gene record:
STAMBP (10617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073973 GCAATATGAATGGAGCTTATT pLKO.1 2018 3UTR 100% 13.200 9.240 N STAMBP n/a
2 TRCN0000299500 GCAATATGAATGGAGCTTATT pLKO_005 2018 3UTR 100% 13.200 9.240 N STAMBP n/a
3 TRCN0000073975 CCAGAGTCAGTAGCCATTGTT pLKO.1 1300 CDS 100% 5.625 3.938 N STAMBP n/a
4 TRCN0000331661 CCAGAGTCAGTAGCCATTGTT pLKO_005 1300 CDS 100% 5.625 3.938 N STAMBP n/a
5 TRCN0000073977 CACAACTGTAAGGCCAGCTAA pLKO.1 888 CDS 100% 4.950 3.465 N STAMBP n/a
6 TRCN0000299499 CACAACTGTAAGGCCAGCTAA pLKO_005 888 CDS 100% 4.950 3.465 N STAMBP n/a
7 TRCN0000073974 GCATCCATTTACTCTGAGGAA pLKO.1 361 CDS 100% 2.640 1.848 N STAMBP n/a
8 TRCN0000073976 TCCAGGAAACTGGATTCTTTA pLKO.1 1334 CDS 100% 1.320 0.924 N STAMBP n/a
9 TRCN0000299424 TCCAGGAAACTGGATTCTTTA pLKO_005 1334 CDS 100% 1.320 0.924 N STAMBP n/a
10 TRCN0000222492 GCAACATTGAACATGCCTTTA pLKO.1 383 CDS 100% 10.800 7.560 N Stambp n/a
11 TRCN0000316062 GCAACATTGAACATGCCTTTA pLKO_005 383 CDS 100% 10.800 7.560 N Stambp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02485 pDONR223 100% 95.7% 95.7% None (many diffs) n/a
2 ccsbBroad304_02485 pLX_304 0% 95.7% 95.7% V5 (many diffs) n/a
3 TRCN0000469931 CCACCAGGTGAAGGTCTGTTTTTA pLX_317 29.5% 95.7% 95.7% V5 (many diffs) n/a
4 ccsbBroadEn_07652 pDONR223 100% 95.6% 95.7% None (many diffs) n/a
5 ccsbBroad304_07652 pLX_304 0% 95.6% 95.7% V5 (many diffs) n/a
6 TRCN0000480622 TGTAAGAACCATGTTGCCGACTGG pLX_317 29.7% 95.6% 95.7% V5 (many diffs) n/a
Download CSV