Transcript: Human NM_001354669.2

Homo sapiens peroxisome proliferator activated receptor gamma (PPARG), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-17
Taxon:
Homo sapiens (human)
Gene:
PPARG (5468)
Length:
1646
CDS:
647..1447

Additional Resources:

NCBI RefSeq record:
NM_001354669.2
NBCI Gene record:
PPARG (5468)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354669.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355862 TCCGTGGATCTCTCCGTAATG pLKO_005 268 5UTR 100% 10.800 15.120 N PPARG n/a
2 TRCN0000001672 GAGATCACAGAGTATGCCAAA pLKO.1 896 CDS 100% 4.050 5.670 N PPARG n/a
3 TRCN0000001671 CTGGCCTCCTTGATGAATAAA pLKO.1 1001 CDS 100% 15.000 10.500 N PPARG n/a
4 TRCN0000355926 ATGGAGTCCACGAGATCATTT pLKO_005 972 CDS 100% 13.200 9.240 N PPARG n/a
5 TRCN0000001673 CAGCATTTCTACTCCACATTA pLKO.1 342 5UTR 100% 13.200 9.240 N PPARG n/a
6 TRCN0000001670 GCCAACATTTCCCTTCTTCCA pLKO.1 1467 3UTR 100% 2.640 1.848 N PPARG n/a
7 TRCN0000355861 GACAGCGACTTGGCAATATTT pLKO_005 1154 CDS 100% 15.000 9.000 N PPARG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354669.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488857 GGCTGTCCTGGAAACAGACATATG pLX_317 25.8% 55.8% 47.8% V5 (not translated due to prior stop codon) 0_1ins427;102_103ins200;798_799insTAGGC n/a
2 ccsbBroadEn_01249 pDONR223 100% 55.7% 47.6% None 0_1ins433;102_103ins200 n/a
3 TRCN0000481296 GTATAACGCCGGAGATCCACGACA pLX_317 29.5% 55.7% 47.6% V5 0_1ins433;102_103ins200 n/a
4 ccsbBroad304_01249 pLX_304 45.7% 55.6% 7.4% V5 (not translated due to prior stop codon) 0_1ins433;102_103ins200;170delC n/a
5 TRCN0000488879 GCAATGGCGCTCTCAGACGTAGTC pLX_317 20.4% 52.6% 45.1% V5 (not translated due to prior stop codon) 0_1ins517;102_103ins200;714C>T n/a
6 TRCN0000489541 AAAGCGGGAAGACGTATTGCCAGG pLX_317 22.5% 52.6% 45.1% V5 (not translated due to prior stop codon) 0_1ins517;102_103ins200;714C>T n/a
Download CSV