Transcript: Human NM_001354698.2

Homo sapiens SECIS binding protein 2 (SECISBP2), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SECISBP2 (79048)
Length:
3274
CDS:
78..2435

Additional Resources:

NCBI RefSeq record:
NM_001354698.2
NBCI Gene record:
SECISBP2 (79048)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230344 ACTCTGTCTCTACCGACATTT pLKO_005 814 CDS 100% 13.200 18.480 N SECISBP2 n/a
2 TRCN0000218104 AGCTAGAGGTTCACATCATTT pLKO_005 599 CDS 100% 13.200 18.480 N SECISBP2 n/a
3 TRCN0000167026 CAGGTGTTAATCTTCTCTAAA pLKO.1 2634 3UTR 100% 13.200 18.480 N SECISBP2 n/a
4 TRCN0000134231 GCAGGTGTTAATCTTCTCTAA pLKO.1 2633 3UTR 100% 4.950 6.930 N SECISBP2 n/a
5 TRCN0000230345 TGCTAATGCCGCTACCAATTC pLKO_005 920 CDS 100% 10.800 8.640 N SECISBP2 n/a
6 TRCN0000135298 CGCAGTTTGAATAAGGCAGTT pLKO.1 2076 CDS 100% 4.050 3.240 N SECISBP2 n/a
7 TRCN0000137651 CACTCAGATGTGCAGGTGTTA pLKO.1 2622 3UTR 100% 4.950 3.465 N SECISBP2 n/a
8 TRCN0000230347 ACTCAGATGTGCAGGTGTTAA pLKO_005 2623 3UTR 100% 13.200 7.920 N SECISBP2 n/a
9 TRCN0000167679 GCCTCAAGAAAGAATAAGAAA pLKO.1 1089 CDS 100% 5.625 3.375 N SECISBP2 n/a
10 TRCN0000167891 CCTGTTAAAGGTCACTCAGAT pLKO.1 2610 3UTR 100% 4.950 2.970 N SECISBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000466797 GGACAAAGAGTTCTATCACCGTCA pLX_317 15.2% 91.8% 91.6% V5 (many diffs) n/a
2 ccsbBroadEn_12536 pDONR223 100% 10.7% 8.1% None 183_303del;374_2355del n/a
3 ccsbBroad304_12536 pLX_304 0% 10.7% 8.1% V5 183_303del;374_2355del n/a
4 TRCN0000473142 GGTAGCTTATCCAACCTAGGTTTT pLX_317 100% 10.7% 8.1% V5 183_303del;374_2355del n/a
Download CSV