Transcript: Human NM_001355239.2

Homo sapiens zinc finger protein 738 (ZNF738), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF738 (148203)
Length:
2381
CDS:
142..555

Additional Resources:

NCBI RefSeq record:
NM_001355239.2
NBCI Gene record:
ZNF738 (148203)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001355239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166364 CACACACACACACACACACAA pLKO.1 587 3UTR 100% 4.950 2.475 Y KAAG1 n/a
2 TRCN0000018501 GCCGTTGACATTTAGGGATGT pLKO.1 240 CDS 100% 4.050 2.025 Y ZNF493 n/a
3 TRCN0000017702 CCCTGGAATATGAAGAGACAT pLKO.1 418 CDS 100% 4.950 2.475 Y ZNF430 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10299 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_10299 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470427 ATGCTGATTAAATGGTCGTCTGCC pLX_317 95.5% 100% 100% V5 n/a
4 ccsbBroadEn_15729 pDONR223 0% 49.1% 45.6% None (many diffs) n/a
5 ccsbBroad304_15729 pLX_304 0% 49.1% 45.6% V5 (many diffs) n/a
6 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 49.1% 45.6% V5 (many diffs) n/a
7 ccsbBroadEn_11549 pDONR223 100% 29.1% 27.5% None (many diffs) n/a
8 ccsbBroad304_11549 pLX_304 94.6% 29.1% 27.5% V5 (many diffs) n/a
9 TRCN0000468281 AACATTAGGAAAGAACCCCCACCC pLX_317 100% 29.1% 27.5% V5 (many diffs) n/a
Download CSV