Transcript: Mouse NM_001359044.1

Mus musculus gamma-aminobutyric acid (GABA) A receptor, subunit alpha 4 (Gabra4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Mus musculus (mouse)
Gene:
Gabra4 (14397)
Length:
3751
CDS:
500..1786

Additional Resources:

NCBI RefSeq record:
NM_001359044.1
NBCI Gene record:
Gabra4 (14397)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001359044.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102951 CCAGTCACATTTGGAGCATTT pLKO.1 1700 CDS 100% 10.800 15.120 N Gabra4 n/a
2 TRCN0000102954 GCTAGAACTGTATTTGGAATA pLKO.1 986 CDS 100% 10.800 15.120 N Gabra4 n/a
3 TRCN0000431993 AGATATGGAGAGAGTTAATTA pLKO_005 1916 3UTR 100% 15.000 12.000 N Gabra4 n/a
4 TRCN0000102952 GCCAATTTGAACATGAGGAAA pLKO.1 1271 CDS 100% 4.950 3.960 N Gabra4 n/a
5 TRCN0000432924 TCAACTATTTCACCAACATTC pLKO_005 1146 CDS 100% 10.800 7.560 N Gabra4 n/a
6 TRCN0000102950 GCTAGAAAGTGAACCATCTTT pLKO.1 1948 3UTR 100% 5.625 3.938 N Gabra4 n/a
7 TRCN0000102953 CAGAACTCAAAGGACGAGAAA pLKO.1 605 CDS 100% 4.950 3.465 N Gabra4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001359044.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06240 pDONR223 100% 66% 67.8% None (many diffs) n/a
2 ccsbBroad304_06240 pLX_304 0% 66% 67.8% V5 (many diffs) n/a
3 TRCN0000480417 TAAGAATAGTCATTTCTTGTCCAC pLX_317 23.6% 66% 67% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV