Transcript: Human NM_001363428.1

Homo sapiens CAS1 domain containing 1 (CASD1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CASD1 (64921)
Length:
3947
CDS:
848..2686

Additional Resources:

NCBI RefSeq record:
NM_001363428.1
NBCI Gene record:
CASD1 (64921)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417982 AGACTGTCTGCACCTGTATTC pLKO_005 3087 3UTR 100% 10.800 15.120 N CASD1 n/a
2 TRCN0000420817 TAGTAATGGATCGACCTTATC pLKO_005 1809 CDS 100% 10.800 15.120 N CASD1 n/a
3 TRCN0000035666 CCCGTTCAGTTTACAGTTCAT pLKO.1 2367 CDS 100% 4.950 6.930 N CASD1 n/a
4 TRCN0000035664 CGGAAATTGTTTCTGGCATTT pLKO.1 1924 CDS 100% 10.800 8.640 N CASD1 n/a
5 TRCN0000035665 CGAGGCAATGATTCGTGTGAA pLKO.1 406 5UTR 100% 4.950 3.960 N CASD1 n/a
6 TRCN0000416130 AGTTCTGGTTGCTGCATATTT pLKO_005 1675 CDS 100% 15.000 10.500 N CASD1 n/a
7 TRCN0000428880 ATGATCTTGCACAGATTATTA pLKO_005 2562 CDS 100% 15.000 10.500 N CASD1 n/a
8 TRCN0000414174 CATCTATCTGGAGATATAAAT pLKO_005 2752 3UTR 100% 15.000 10.500 N CASD1 n/a
9 TRCN0000428103 ATGAAGGCAGGGAAATGATTA pLKO_005 2984 3UTR 100% 13.200 9.240 N CASD1 n/a
10 TRCN0000035668 GCTGGATGCAACTTGTGATTT pLKO.1 1599 CDS 100% 13.200 9.240 N CASD1 n/a
11 TRCN0000421353 GGCTTTGCAGAAGCGTCAAAT pLKO_005 2146 CDS 100% 13.200 9.240 N CASD1 n/a
12 TRCN0000412529 TCCTGTTTATGAAGATCTATT pLKO_005 922 CDS 100% 13.200 9.240 N CASD1 n/a
13 TRCN0000121046 CTGCATCAGTTAAAGTGGATT pLKO.1 656 5UTR 100% 4.950 3.465 N Casd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08879 pDONR223 100% 76.6% 76.6% None (many diffs) n/a
2 ccsbBroad304_08879 pLX_304 0% 76.6% 76.6% V5 (many diffs) n/a
3 TRCN0000477946 TTTTGACAAAGTAGCTATTCAATA pLX_317 12.1% 76.6% 76.6% V5 (many diffs) n/a
Download CSV