Transcript: Human NM_001363523.2

Homo sapiens oxoglutarate dehydrogenase (OGDH), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
OGDH (4967)
Length:
4226
CDS:
55..3159

Additional Resources:

NCBI RefSeq record:
NM_001363523.2
NBCI Gene record:
OGDH (4967)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426189 CATTCCGGAAGCCGTTAATTA pLKO_005 2633 CDS 100% 15.000 21.000 N OGDH n/a
2 TRCN0000412481 TTCTGTCAATTCGATTCAAAG pLKO_005 1075 CDS 100% 10.800 15.120 N OGDH n/a
3 TRCN0000220903 GCTGTCATGTACGTGTGCAAA pLKO.1 1531 CDS 100% 4.950 6.930 N OGDH n/a
4 TRCN0000041904 CCTCTCGGAATTAGTTGTGTA pLKO.1 499 CDS 100% 4.950 3.960 N Ogdh n/a
5 TRCN0000420393 AGGCACAGGCTCCTGTATTTG pLKO_005 3535 3UTR 100% 13.200 9.240 N OGDH n/a
6 TRCN0000220904 CCTGAGTATGAGGAGGAAATT pLKO.1 1744 CDS 100% 13.200 9.240 N OGDH n/a
7 TRCN0000428647 TTCGCCATGGCCAGTCCTAAT pLKO_005 2281 CDS 100% 10.800 7.560 N OGDH n/a
8 TRCN0000220905 GAAGCCAACTTCGACATCAAT pLKO.1 2527 CDS 100% 5.625 3.938 N OGDH n/a
9 TRCN0000220907 GACTACGTGAAGCCAAGACTT pLKO.1 2986 CDS 100% 4.950 3.465 N OGDH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15515 pDONR223 0% 39.1% 37.7% None (many diffs) n/a
2 ccsbBroad304_15515 pLX_304 0% 39.1% 37.7% V5 (many diffs) n/a
3 TRCN0000479889 AACGTAAGATGCATCTGACTCGGC pLX_317 29.4% 39.1% 37.7% V5 (many diffs) n/a
Download CSV