Transcript: Human NM_001363552.2

Homo sapiens cholecystokinin B receptor (CCKBR), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CCKBR (887)
Length:
2226
CDS:
92..1642

Additional Resources:

NCBI RefSeq record:
NM_001363552.2
NBCI Gene record:
CCKBR (887)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005902 CGTCCCTAGCAGTGAACTATT pLKO.1 1897 3UTR 100% 13.200 18.480 N CCKBR n/a
2 TRCN0000356409 GTCCCTAGCAGTGAACTATTT pLKO_005 1898 3UTR 100% 13.200 18.480 N CCKBR n/a
3 TRCN0000368612 GTGTTGGTTGCCAGTTTATAG pLKO_005 1330 CDS 100% 13.200 18.480 N CCKBR n/a
4 TRCN0000005905 CACTCTTTACGCAGTGATCTT pLKO.1 265 CDS 100% 4.950 6.930 N CCKBR n/a
5 TRCN0000356349 CTCTCACACACATAGATTAAT pLKO_005 1954 3UTR 100% 15.000 10.500 N CCKBR n/a
6 TRCN0000356410 GGCCATTAGAATCACTCTTTA pLKO_005 253 CDS 100% 13.200 9.240 N CCKBR n/a
7 TRCN0000005904 GCTTCTGCTCTTGTTCTTCAT pLKO.1 757 CDS 100% 4.950 3.465 N CCKBR n/a
8 TRCN0000005903 CGAATGTTGCTGGTGATCGTT pLKO.1 1295 CDS 100% 3.000 2.100 N CCKBR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05945 pDONR223 100% 86.5% 86.6% None 423C>T;809_1015del n/a
2 ccsbBroad304_05945 pLX_304 0% 86.5% 86.6% V5 423C>T;809_1015del n/a
3 TRCN0000467911 ACTGGCAAGCTCCACCCTGCATCA pLX_317 21.8% 86.5% 86.6% V5 423C>T;809_1015del n/a
4 TRCN0000489736 CATATCTTAGGAAGGAATTCTCAA pLX_317 30.3% 86.5% 86.4% V5 (not translated due to prior stop codon) 617T>C;809_1015del n/a
5 TRCN0000489791 GGGGCTCAAACATGTTCATGTGAC pLX_317 28.8% 86.5% 86.2% V5 617T>C;809_1015del;1548_1549insG n/a
Download CSV