Transcript: Human NM_001363887.1

Homo sapiens leucine rich repeats and calponin homology domain containing 3 (LRCH3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
LRCH3 (84859)
Length:
10186
CDS:
54..2465

Additional Resources:

NCBI RefSeq record:
NM_001363887.1
NBCI Gene record:
LRCH3 (84859)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363887.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242705 CAGACGATCACCCTAGATAAC pLKO_005 783 CDS 100% 10.800 15.120 N LRCH3 n/a
2 TRCN0000242707 TAATAGACCAACTGCGTAAAC pLKO_005 2026 CDS 100% 10.800 15.120 N LRCH3 n/a
3 TRCN0000242703 TCACAGTTTATGGCGTATATT pLKO_005 1260 CDS 100% 15.000 12.000 N LRCH3 n/a
4 TRCN0000242706 ACAGACCTAATGCTCTATTAA pLKO_005 1777 CDS 100% 15.000 10.500 N LRCH3 n/a
5 TRCN0000242704 CGAGTAGCAGAGATTACTAAA pLKO_005 1065 CDS 100% 13.200 9.240 N LRCH3 n/a
6 TRCN0000168079 CAGAAGAAATTGGACACCTTA pLKO.1 550 CDS 100% 4.950 3.465 N LRCH3 n/a
7 TRCN0000168762 GCAACAGAAACAGTTCATCAT pLKO.1 1806 CDS 100% 4.950 3.465 N LRCH3 n/a
8 TRCN0000168182 CACTGATTCTACAGATTCCAT pLKO.1 1964 CDS 100% 3.000 2.100 N LRCH3 n/a
9 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 6054 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
10 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 7263 3UTR 100% 10.800 5.400 Y SMIM11A n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6620 3UTR 100% 5.625 2.813 Y EID2B n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6620 3UTR 100% 5.625 2.813 Y KLHL30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363887.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04433 pDONR223 100% 88.5% 88.4% None (many diffs) n/a
2 ccsbBroad304_04433 pLX_304 0% 88.5% 88.4% V5 (many diffs) n/a
3 TRCN0000474219 CCAACCCAACTGCGAGTAGGCGGA pLX_317 15.3% 88.5% 88.4% V5 (many diffs) n/a
Download CSV