Transcript: Human NM_001364178.1

Homo sapiens acyl-CoA thioesterase 2 (ACOT2), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-09
Taxon:
Homo sapiens (human)
Gene:
ACOT2 (10965)
Length:
1150
CDS:
183..1112

Additional Resources:

NCBI RefSeq record:
NM_001364178.1
NBCI Gene record:
ACOT2 (10965)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048890 CAGTTGTTCTCAGGTCTGAAT pLKO.1 217 CDS 100% 4.950 6.930 N ACOT2 n/a
2 TRCN0000415308 GCAGGTTGGTCAGATCATTAG pLKO_005 335 CDS 100% 10.800 7.560 N ACOT2 n/a
3 TRCN0000426273 AGCCATGAACTACTTGCTCAG pLKO_005 998 CDS 100% 2.250 1.575 N ACOT2 n/a
4 TRCN0000048892 GCTGTACCAATGGAGCCTGAA pLKO.1 278 CDS 100% 4.050 2.430 N ACOT2 n/a
5 TRCN0000438195 TGGGATTGTGGACATGTTCGG pLKO_005 842 CDS 100% 2.160 1.296 N ACOT2 n/a
6 TRCN0000418470 ACCTTTGGTGCGGCTGGTGAA pLKO_005 632 CDS 100% 1.350 0.810 N ACOT2 n/a
7 TRCN0000256063 CGCTCCATCTGGAGTACTTTG pLKO_005 973 CDS 100% 10.800 5.400 Y ACOT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14981 pDONR223 61.1% 61.6% 58.1% None (many diffs) n/a
2 ccsbBroad304_14981 pLX_304 0% 61.6% 58.1% V5 (many diffs) n/a
3 ccsbBroadEn_11575 pDONR223 100% 49.1% 46.3% None (many diffs) n/a
4 ccsbBroad304_11575 pLX_304 0% 49.1% 46.3% V5 (many diffs) n/a
5 TRCN0000474153 TCGCATTATGGCTAGCACCCCGAG pLX_317 29.2% 49.1% 46.3% V5 (many diffs) n/a
6 ccsbBroadEn_05709 pDONR223 100% 48.2% 45.5% None (many diffs) n/a
7 ccsbBroad304_05709 pLX_304 0% 48.2% 45.5% V5 (many diffs) n/a
8 TRCN0000471582 GGATCAACTACTTCAAAAATGGGA pLX_317 37% 48.2% 45.5% V5 (many diffs) n/a
Download CSV