Transcript: Human NM_001364948.2

Homo sapiens acylglycerol kinase (AGK), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
AGK (55750)
Length:
1212
CDS:
40..1092

Additional Resources:

NCBI RefSeq record:
NM_001364948.2
NBCI Gene record:
AGK (55750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364948.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236010 TCCATCACAACACGGAATAAT pLKO_005 979 CDS 100% 15.000 10.500 N AGK n/a
2 TRCN0000358622 CATCAAGCCTCTATCTCATAC pLKO_005 781 CDS 100% 10.800 7.560 N AGK n/a
3 TRCN0000358552 TCAGAGATGCTGGCGTCAAAG pLKO_005 680 CDS 100% 10.800 7.560 N AGK n/a
4 TRCN0000152111 CAGTAAGATTCCCATTGGATT pLKO.1 471 CDS 100% 4.950 3.465 N AGK n/a
5 TRCN0000153540 CCATTGAACTGTCCATCACAA pLKO.1 968 CDS 100% 4.950 3.465 N AGK n/a
6 TRCN0000156414 CCACCATTGAACTGTCCATCA pLKO.1 965 CDS 100% 4.050 2.835 N AGK n/a
7 TRCN0000157186 GAAGCTCAGGTGTTTGGCAAT pLKO.1 172 CDS 100% 4.050 2.835 N AGK n/a
8 TRCN0000236009 ATCAGCAAAGGAGACTTTATA pLKO_005 1057 CDS 100% 15.000 9.000 N AGK n/a
9 TRCN0000236012 TAAGATTCCCATTGGATTTAT pLKO_005 474 CDS 100% 15.000 9.000 N AGK n/a
10 TRCN0000236011 TGGAAACAAAGTCCAACATAT pLKO_005 543 CDS 100% 13.200 7.920 N AGK n/a
11 TRCN0000361857 TGGAAACAAAGTCCAACATAT pLKO_005 543 CDS 100% 13.200 7.920 N Agk n/a
12 TRCN0000024801 CCCAATGCACAAGTGAAGAAA pLKO.1 205 CDS 100% 5.625 3.938 N Agk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364948.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08577 pDONR223 100% 82.7% 82.7% None 228C>T;1045delG;1050_1051ins217 n/a
2 ccsbBroad304_08577 pLX_304 0% 82.7% 82.7% V5 228C>T;1045delG;1050_1051ins217 n/a
3 TRCN0000471201 TCAACACGTGCAGTGTTACCCGGG pLX_317 33% 82.7% 82.7% V5 228C>T;1045delG;1050_1051ins217 n/a
4 ccsbBroadEn_15107 pDONR223 0% 82.7% 82.7% None 228C>T;1045delG;1050_1051ins217 n/a
5 TRCN0000472791 ATAGCGTTCTCAGCCTTGGACTTT pLX_317 32.8% 82.7% 82.7% V5 228C>T;1045delG;1050_1051ins217 n/a
6 ccsbBroadEn_15913 pDONR223 0% 17.2% 14% None (many diffs) n/a
7 ccsbBroad304_15913 pLX_304 0% 17.2% 14% V5 (many diffs) n/a
8 TRCN0000478316 TCATCTGTGTCTAATATGCCCTTC pLX_317 100% 17.2% 14% V5 (many diffs) n/a
Download CSV