Transcript: Human NM_001365778.1

Homo sapiens tropomyosin 1 (TPM1), transcript variant 15, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TPM1 (7168)
Length:
1807
CDS:
84..1064

Additional Resources:

NCBI RefSeq record:
NM_001365778.1
NBCI Gene record:
TPM1 (7168)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365778.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438285 CTGAAGATGCCGACCGCAAAT pLKO_005 673 CDS 100% 10.800 15.120 N TPM1 n/a
2 TRCN0000062149 CGGAGAGGTCAGTAACTAAAT pLKO.1 934 CDS 100% 13.200 9.240 N TPM1 n/a
3 TRCN0000062151 GCCCGTAAGCTGGTCATCATT pLKO.1 705 CDS 100% 5.625 3.938 N TPM1 n/a
4 TRCN0000062152 CACCGAAGATGAACTGGACAA pLKO.1 365 CDS 100% 4.050 2.835 N TPM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365778.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07090 pDONR223 100% 78.3% 75.4% None (many diffs) n/a
2 ccsbBroad304_07090 pLX_304 0% 78.3% 75.4% V5 (many diffs) n/a
3 TRCN0000492218 CAAACTCGTCTCTACCATCGTAAC pLX_317 61.1% 78.3% 75.4% V5 (many diffs) n/a
4 ccsbBroadEn_07091 pDONR223 100% 67.7% 58.2% None (many diffs) n/a
5 ccsbBroad304_07091 pLX_304 0% 67.7% 58.2% V5 (many diffs) n/a
6 TRCN0000481549 GATCAAGGGTCTCTCCCCTACTAG pLX_317 63.1% 67.7% 58.2% V5 (many diffs) n/a
Download CSV