Transcript: Human NM_001367471.1

Homo sapiens autophagy and beclin 1 regulator 1 (AMBRA1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
AMBRA1 (55626)
Length:
4979
CDS:
317..3943

Additional Resources:

NCBI RefSeq record:
NM_001367471.1
NBCI Gene record:
AMBRA1 (55626)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367471.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438302 CCACTGCGAGTTGACCAATAA pLKO_005 3850 CDS 100% 13.200 18.480 N AMBRA1 n/a
2 TRCN0000438018 GTGGGCACAAGACAGTCAAAT pLKO_005 4093 3UTR 100% 13.200 18.480 N AMBRA1 n/a
3 TRCN0000439777 ACGGAACAGGTAGAGACAAAC pLKO_005 3931 CDS 100% 10.800 15.120 N AMBRA1 n/a
4 TRCN0000425163 GTGACCTGAGACGCTTCTTTC pLKO_005 1548 CDS 100% 10.800 15.120 N AMBRA1 n/a
5 TRCN0000435785 TCAGTAATGCTTCCGTGAATG pLKO_005 2670 CDS 100% 10.800 15.120 N AMBRA1 n/a
6 TRCN0000167238 CCTCATTTCATTATCCCGTTA pLKO.1 2137 CDS 100% 4.050 5.670 N AMBRA1 n/a
7 TRCN0000441636 GGCCACTGGGAAAGAATTTAC pLKO_005 2009 CDS 100% 13.200 10.560 N AMBRA1 n/a
8 TRCN0000413151 GAGGTTAGGATTTGGGATTTA pLKO_005 671 CDS 100% 13.200 9.240 N AMBRA1 n/a
9 TRCN0000443104 GTCCACGCTCTACCTTCTTAT pLKO_005 471 CDS 100% 13.200 9.240 N AMBRA1 n/a
10 TRCN0000425683 AGCCTCTCTTCGTCGTCTTAC pLKO_005 4422 3UTR 100% 10.800 7.560 N AMBRA1 n/a
11 TRCN0000429045 ATGCTCTACACCAAGCGATTT pLKO_005 2846 CDS 100% 10.800 7.560 N AMBRA1 n/a
12 TRCN0000417120 GGCTTGGCCTATGGTACTAAC pLKO_005 3113 CDS 100% 10.800 7.560 N AMBRA1 n/a
13 TRCN0000167886 CCCACTTTCTCCTAGTAACAT pLKO.1 4224 3UTR 100% 5.625 3.938 N AMBRA1 n/a
14 TRCN0000432616 AGAGCCTCCAGAGAGTGAACA pLKO_005 4272 3UTR 100% 4.950 3.465 N AMBRA1 n/a
15 TRCN0000168355 GAGATTATCTCCTGCTGCATA pLKO.1 2203 CDS 100% 4.950 3.465 N AMBRA1 n/a
16 TRCN0000168652 GCATGTGGACTCTTAACTGTA pLKO.1 4781 3UTR 100% 4.950 3.465 N AMBRA1 n/a
17 TRCN0000172299 CTGATGAATGCCATTGGGCTT pLKO.1 3296 CDS 100% 2.160 1.512 N AMBRA1 n/a
18 TRCN0000189704 GCATTCGCCATGAGCTTCAAT pLKO.1 1527 CDS 100% 5.625 7.875 N Ambra1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367471.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08557 pDONR223 100% 99.9% 99.8% None 102A>G;3043C>G;3532C>G n/a
2 ccsbBroad304_08557 pLX_304 0% 99.9% 99.8% V5 102A>G;3043C>G;3532C>G n/a
3 TRCN0000481129 TCCAACTATCCCTTACAAGCGGAA pLX_317 10.5% 99.9% 99.8% V5 102A>G;3043C>G;3532C>G n/a
Download CSV