Transcript: Human NM_001367633.1

Homo sapiens Sad1 and UNC84 domain containing 1 (SUN1), transcript variant 73, mRNA.

Source:
NCBI, updated 2019-05-07
Taxon:
Homo sapiens (human)
Gene:
SUN1 (23353)
Length:
4012
CDS:
52..2409

Additional Resources:

NCBI RefSeq record:
NM_001367633.1
NBCI Gene record:
SUN1 (23353)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367633.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133655 GCTGTTCTGAAACTTACGAAA pLKO.1 1937 CDS 100% 4.950 3.960 N SUN1 n/a
2 TRCN0000297311 GCTGTTCTGAAACTTACGAAA pLKO_005 1937 CDS 100% 4.950 3.960 N SUN1 n/a
3 TRCN0000297312 TTCATGGACGAGGGCATATAC pLKO_005 2474 3UTR 100% 13.200 9.240 N SUN1 n/a
4 TRCN0000137700 GCAGAGGTTCTCATCACAGTT pLKO.1 1653 CDS 100% 4.950 3.465 N SUN1 n/a
5 TRCN0000138694 GAGCACAAATTGGACCCTGTA pLKO.1 166 CDS 100% 4.050 2.835 N SUN1 n/a
6 TRCN0000135899 GAACTAGAACAGACCAAGCAA pLKO.1 1414 CDS 100% 3.000 2.100 N SUN1 n/a
7 TRCN0000279614 GAACTAGAACAGACCAAGCAA pLKO_005 1414 CDS 100% 3.000 2.100 N SUN1 n/a
8 TRCN0000134596 GCTTTCCAAATAGTGGAACTT pLKO.1 2311 CDS 100% 0.495 0.347 N SUN1 n/a
9 TRCN0000279683 GCTTTCCAAATAGTGGAACTT pLKO_005 2311 CDS 100% 0.495 0.347 N SUN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367633.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07869 pDONR223 100% 31% 27.2% None (many diffs) n/a
2 ccsbBroad304_07869 pLX_304 0% 31% 27.2% V5 (many diffs) n/a
3 TRCN0000469980 ACCATAGATGCTGGCCTTCCTACA pLX_317 64.6% 31% 27.2% V5 (many diffs) n/a
Download CSV