Transcript: Human NM_001367788.1

Homo sapiens ATPase H+ transporting V0 subunit e2 (ATP6V0E2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ATP6V0E2 (155066)
Length:
2445
CDS:
981..1427

Additional Resources:

NCBI RefSeq record:
NM_001367788.1
NBCI Gene record:
ATP6V0E2 (155066)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082735 GCTCTGGAGTTTGCCCTCTTT pLKO.1 1321 CDS 100% 4.950 3.465 N ATP6V0E2 n/a
2 TRCN0000290554 GCTCTGGAGTTTGCCCTCTTT pLKO_005 1321 CDS 100% 4.950 3.465 N ATP6V0E2 n/a
3 TRCN0000082736 CCACACAACTATGTCTGGTCA pLKO.1 1150 CDS 100% 2.640 1.848 N ATP6V0E2 n/a
4 TRCN0000290553 CCACACAACTATGTCTGGTCA pLKO_005 1150 CDS 100% 2.640 1.848 N ATP6V0E2 n/a
5 TRCN0000082734 CCAGCTGAAGAATGAGACCAT pLKO.1 1061 CDS 100% 2.640 1.848 N ATP6V0E2 n/a
6 TRCN0000382121 ATTCGCCCTCCCGGTCATCAT pLKO_005 112 5UTR 100% 1.650 1.155 N ATP6V0E2 n/a
7 TRCN0000082733 CAGAGAAACATTCACACACAA pLKO.1 1619 3UTR 100% 4.950 2.970 N ATP6V0E2 n/a
8 TRCN0000307213 CAGAGAAACATTCACACACAA pLKO_005 1619 3UTR 100% 4.950 2.970 N ATP6V0E2 n/a
9 TRCN0000379478 AGCTGAAGAATGAGACCATCT pLKO_005 1063 CDS 100% 4.050 2.430 N ATP6V0E2 n/a
10 TRCN0000082737 CTGTTACCTCTTCTGGCTCAT pLKO.1 1004 CDS 100% 4.050 2.430 N ATP6V0E2 n/a
11 TRCN0000307210 CTGTTACCTCTTCTGGCTCAT pLKO_005 1004 CDS 100% 4.050 2.430 N ATP6V0E2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13298 pDONR223 100% 21.6% 11.2% None 1_316del;444_445ins148 n/a
2 ccsbBroad304_13298 pLX_304 0% 21.6% 11.2% V5 1_316del;444_445ins148 n/a
3 TRCN0000465609 AATAAATTTCGAACCAGTGAATAT pLX_317 100% 21.6% 11.2% V5 1_316del;444_445ins148 n/a
Download CSV