Transcript: Human NM_001369601.1

Homo sapiens suppression of tumorigenicity 7 (ST7), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ST7 (7982)
Length:
2078
CDS:
41..1759

Additional Resources:

NCBI RefSeq record:
NM_001369601.1
NBCI Gene record:
ST7 (7982)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293889 GTGGTTCTTCATCGTGCTATT pLKO_005 118 CDS 100% 10.800 15.120 N ST7 n/a
2 TRCN0000038059 CCTCACTAATATCAGGGCTTA pLKO.1 249 CDS 100% 4.050 3.240 N ST7 n/a
3 TRCN0000293890 TGGCGAAATCCACTAAATTTA pLKO_005 446 CDS 100% 15.000 10.500 N ST7 n/a
4 TRCN0000038060 CCCAGTATGAAGCCCAACATA pLKO.1 885 CDS 100% 5.625 3.938 N ST7 n/a
5 TRCN0000286521 CCCAGTATGAAGCCCAACATA pLKO_005 885 CDS 100% 5.625 3.938 N ST7 n/a
6 TRCN0000038063 GCAGATGCAATAATGCAGAAA pLKO.1 596 CDS 100% 4.950 3.465 N ST7 n/a
7 TRCN0000038061 GCTGATGTTCAGGCAGTCTTA pLKO.1 1085 CDS 100% 4.950 3.465 N ST7 n/a
8 TRCN0000286522 GCTGATGTTCAGGCAGTCTTA pLKO_005 1085 CDS 100% 4.950 3.465 N ST7 n/a
9 TRCN0000038062 GCTTCCCTTCTTTATTCTCTT pLKO.1 1558 CDS 100% 4.950 3.465 N ST7 n/a
10 TRCN0000286453 GCTTCCCTTCTTTATTCTCTT pLKO_005 1558 CDS 100% 4.950 3.465 N ST7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07193 pDONR223 100% 94.8% 93% None (many diffs) n/a
2 ccsbBroad304_07193 pLX_304 0% 94.8% 93% V5 (many diffs) n/a
3 TRCN0000468200 TTACGAATGGATTTTAGCATAAAT pLX_317 21.8% 94.8% 93% V5 (many diffs) n/a
4 ccsbBroadEn_11249 pDONR223 100% 93.9% 93.7% None 344_364del;641_709del;1390_1391insGTACGTGGGAAGGCA n/a
5 ccsbBroad304_11249 pLX_304 0% 93.9% 93.7% V5 344_364del;641_709del;1390_1391insGTACGTGGGAAGGCA n/a
6 TRCN0000479746 TGGCTCGCTACCTCCTCGCAGCAC pLX_317 21.8% 93.9% 93.7% V5 344_364del;641_709del;1390_1391insGTACGTGGGAAGGCA n/a
Download CSV