Transcript: Human NM_001370747.1

Homo sapiens angel homolog 1 (ANGEL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ANGEL1 (23357)
Length:
5446
CDS:
56..2227

Additional Resources:

NCBI RefSeq record:
NM_001370747.1
NBCI Gene record:
ANGEL1 (23357)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370747.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130699 CCCACAGACCTGGTGTAATTT pLKO.1 2989 3UTR 100% 15.000 12.000 N ANGEL1 n/a
2 TRCN0000292423 CCCACAGACCTGGTGTAATTT pLKO_005 2989 3UTR 100% 15.000 12.000 N ANGEL1 n/a
3 TRCN0000128671 CCTAGGTTCTAGGGAATTTAT pLKO.1 3846 3UTR 100% 15.000 10.500 N ANGEL1 n/a
4 TRCN0000292504 GAGCTACTTAATCGGGATAAT pLKO_005 1124 CDS 100% 13.200 9.240 N ANGEL1 n/a
5 TRCN0000128874 GACCTAAATTCTGTCCCTGAT pLKO.1 1352 CDS 100% 4.050 2.835 N ANGEL1 n/a
6 TRCN0000127505 CAGAGGTCACTACAATGCCAT pLKO.1 1977 CDS 100% 2.640 1.848 N ANGEL1 n/a
7 TRCN0000292425 CAGAGGTCACTACAATGCCAT pLKO_005 1977 CDS 100% 2.640 1.848 N ANGEL1 n/a
8 TRCN0000128795 CATCACTGATTGCTGTCAGTA pLKO.1 1672 CDS 100% 0.495 0.347 N ANGEL1 n/a
9 TRCN0000292424 CATCACTGATTGCTGTCAGTA pLKO_005 1672 CDS 100% 0.495 0.347 N ANGEL1 n/a
10 TRCN0000422401 TGGCGAGAATGGGAGGATTTC pLKO_005 713 CDS 100% 10.800 6.480 N Angel1 n/a
11 TRCN0000128796 CCAGTTCACTCTGATGTCTTA pLKO.1 784 CDS 100% 4.950 2.970 N ANGEL1 n/a
12 TRCN0000292426 CCAGTTCACTCTGATGTCTTA pLKO_005 784 CDS 100% 4.950 2.970 N ANGEL1 n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5013 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5013 3UTR 100% 4.950 2.475 Y C19orf31 n/a
15 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5177 3UTR 100% 10.800 5.400 Y SMIM11A n/a
16 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5011 3UTR 100% 4.950 2.475 Y ERN2 n/a
17 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5011 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5011 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370747.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07870 pDONR223 100% 92.6% 92.5% None 1244A>G;1380_1538del n/a
2 ccsbBroad304_07870 pLX_304 0% 92.6% 92.5% V5 1244A>G;1380_1538del n/a
3 TRCN0000479304 ATACAAATCGATTCTACTCCTATA pLX_317 19.5% 92.6% 92.5% V5 1244A>G;1380_1538del n/a
Download CSV