Transcript: Human NM_001371200.1

Homo sapiens semaphorin 4D (SEMA4D), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
SEMA4D (10507)
Length:
4646
CDS:
815..3031

Additional Resources:

NCBI RefSeq record:
NM_001371200.1
NBCI Gene record:
SEMA4D (10507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166020 GAACAAGACTTCGAAGGTGCA pLKO.1 2866 CDS 100% 2.160 1.728 N SEMA4D n/a
2 TRCN0000058146 CCTGAACTTAACATCCTTTAA pLKO.1 1225 CDS 100% 13.200 9.240 N SEMA4D n/a
3 TRCN0000166112 GCTTTGTCTGGGAGAAGAATG pLKO.1 2712 CDS 100% 10.800 7.560 N SEMA4D n/a
4 TRCN0000166713 CGCTTTGTCTGGGAGAAGAAT pLKO.1 2711 CDS 100% 5.625 3.938 N SEMA4D n/a
5 TRCN0000163269 GATGGCTAACAGGCTTTGATA pLKO.1 3307 3UTR 100% 5.625 3.938 N SEMA4D n/a
6 TRCN0000163322 GAGTGCATCTGTCAAGTCTTT pLKO.1 3639 3UTR 100% 4.950 3.465 N SEMA4D n/a
7 TRCN0000058145 GCCTGTGTTCTATGCACTCTT pLKO.1 1732 CDS 100% 4.950 3.465 N SEMA4D n/a
8 TRCN0000166171 CATGGAAATGCCTTGCCCTAA pLKO.1 3589 3UTR 100% 4.050 2.835 N SEMA4D n/a
9 TRCN0000165981 GCTTTGATAGCTGCTCGTGAA pLKO.1 3319 3UTR 100% 4.050 2.835 N SEMA4D n/a
10 TRCN0000166144 CATTCGCTTTGTCTGGGAGAA pLKO.1 2707 CDS 100% 4.050 2.430 N SEMA4D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07622 pDONR223 100% 76.2% 63.9% None (many diffs) n/a
2 ccsbBroad304_07622 pLX_304 0% 76.2% 63.9% V5 (many diffs) n/a
3 TRCN0000477171 GCAGCCTCTACCCCGGGCTTGGTT pLX_317 100% 16.1% 14.8% V5 (many diffs) n/a
4 ccsbBroadEn_14048 pDONR223 100% 16% 14.9% None (many diffs) n/a
5 ccsbBroad304_14048 pLX_304 0% 16% 14.9% V5 (many diffs) n/a
Download CSV