Transcript: Human NM_001371428.1

Homo sapiens cAMP responsive element binding protein 1 (CREB1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
CREB1 (1385)
Length:
9934
CDS:
141..1004

Additional Resources:

NCBI RefSeq record:
NM_001371428.1
NBCI Gene record:
CREB1 (1385)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226467 ACGGTGCCAACTCCAATTTAC pLKO_005 483 CDS 100% 13.200 18.480 N CREB1 n/a
2 TRCN0000011085 CAGTGGATAGTGTAACTGATT pLKO.1 319 CDS 100% 4.950 6.930 N CREB1 n/a
3 TRCN0000007308 GCTCGATAAATCTAACAGTTA pLKO.1 2407 3UTR 100% 4.950 6.930 N CREB1 n/a
4 TRCN0000007310 CGTCTAATGAAGAACAGGGAA pLKO.1 843 CDS 100% 2.640 3.696 N CREB1 n/a
5 TRCN0000226469 ACCAATCCCTTGAGTTATATA pLKO_005 1841 3UTR 100% 15.000 12.000 N CREB1 n/a
6 TRCN0000218546 ACGTACAAACATACCAGATTC pLKO_005 721 CDS 100% 10.800 8.640 N CREB1 n/a
7 TRCN0000226468 ACAGCACCCACTAGCACTATT pLKO_005 744 CDS 100% 13.200 9.240 N CREB1 n/a
8 TRCN0000378139 CAATACAGCTGGCTAACAATG pLKO_005 547 CDS 100% 10.800 7.560 N CREB1 n/a
9 TRCN0000304386 CAGTTCAGATTTCAACTATTG pLKO_005 274 CDS 100% 10.800 7.560 N Creb1 n/a
10 TRCN0000356000 GGAGTCAGTGGATAGTGTAAC pLKO_005 314 CDS 100% 10.800 7.560 N CREB1 n/a
11 TRCN0000096629 GCCTGAAAGCAACTACAGAAT pLKO.1 1121 3UTR 100% 4.950 3.465 N Creb1 n/a
12 TRCN0000301658 GCCTGAAAGCAACTACAGAAT pLKO_005 1121 3UTR 100% 4.950 3.465 N Creb1 n/a
13 TRCN0000356046 GCCTGAAAGCAACTACAGAAT pLKO_005 1121 3UTR 100% 4.950 3.465 N CREB1 n/a
14 TRCN0000007309 GCAAACATTAACCATGACCAA pLKO.1 590 CDS 100% 2.640 1.848 N CREB1 n/a
15 TRCN0000096631 CAGCAGCTCATGCAACATCAT pLKO.1 145 CDS 100% 4.950 2.475 Y Creb1 n/a
16 TRCN0000301735 CAGCAGCTCATGCAACATCAT pLKO_005 145 CDS 100% 4.950 2.475 Y Creb1 n/a
17 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2530 3UTR 100% 4.950 2.475 Y ERAP2 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2531 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00360 pDONR223 100% 84.1% 84.1% None 0_1ins120;138_139ins42 n/a
2 ccsbBroad304_00360 pLX_304 26.2% 84.1% 84.1% V5 0_1ins120;138_139ins42 n/a
3 TRCN0000475150 GGTGTGTATCCTCGACAATTCGGG pLX_317 58.1% 84.1% 84.1% V5 0_1ins120;138_139ins42 n/a
Download CSV