Transcript: Human NM_001371482.1

Homo sapiens MAPK activated protein kinase 5 (MAPKAPK5), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
MAPKAPK5 (8550)
Length:
10999
CDS:
507..1838

Additional Resources:

NCBI RefSeq record:
NM_001371482.1
NBCI Gene record:
MAPKAPK5 (8550)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146604 CCACAGCCGGACTATCCCAA pXPR_003 AGG 661 50% 8 0.3833 MAPKAPK5 MAPKAPK5 76447
2 BRDN0001147153 GGAGGAGAGACTCACCATCG pXPR_003 AGG 793 60% 9 0.3005 MAPKAPK5 MAPKAPK5 76448
3 BRDN0001145783 GGGGTGTCATCAAGTCACCT pXPR_003 TGG 443 33% 6 0.2627 MAPKAPK5 MAPKAPK5 76449
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371482.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000683 GACGCCCTACACTTACAACAA pLKO.1 1055 CDS 100% 4.950 6.930 N MAPKAPK5 n/a
2 TRCN0000338270 AGATAAAGTAGATCGACTAAA pLKO_005 1757 CDS 100% 13.200 9.240 N MAPKAPK5 n/a
3 TRCN0000338271 AGTTCTAGAGACATACTATTA pLKO_005 2017 3UTR 100% 13.200 9.240 N MAPKAPK5 n/a
4 TRCN0000195326 CCAAAGGACAGTGTCTATATC pLKO.1 1524 CDS 100% 13.200 9.240 N MAPKAPK5 n/a
5 TRCN0000194823 CCCAAACATAGTTCAGATTAT pLKO.1 722 CDS 100% 13.200 9.240 N MAPKAPK5 n/a
6 TRCN0000338268 CCCAAACATAGTTCAGATTAT pLKO_005 722 CDS 100% 13.200 9.240 N MAPKAPK5 n/a
7 TRCN0000000684 GAAGGCATCAGAAGGAGAAAT pLKO.1 1012 CDS 100% 13.200 9.240 N MAPKAPK5 n/a
8 TRCN0000338269 GAAGGCATCAGAAGGAGAAAT pLKO_005 1012 CDS 100% 13.200 9.240 N MAPKAPK5 n/a
9 TRCN0000197148 GATTTAGGGTGCAGGACTTAA pLKO.1 1959 3UTR 100% 13.200 9.240 N MAPKAPK5 n/a
10 TRCN0000195607 CAGATGATGCTGTCAAGCAAT pLKO.1 2073 3UTR 100% 4.950 3.465 N MAPKAPK5 n/a
11 TRCN0000195129 CAGTATCAATTGGACTCAGAA pLKO.1 566 CDS 100% 4.950 3.465 N MAPKAPK5 n/a
12 TRCN0000000682 GAAATTGTGAAGCAGGTGATA pLKO.1 1785 CDS 100% 4.950 3.465 N MAPKAPK5 n/a
13 TRCN0000350903 GAAATTGTGAAGCAGGTGATA pLKO_005 1785 CDS 100% 4.950 3.465 N MAPKAPK5 n/a
14 TRCN0000000680 GCTGTATAGATTTAGGGTGCA pLKO.1 1951 3UTR 100% 2.160 1.512 N MAPKAPK5 n/a
15 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3004 3UTR 100% 4.950 2.475 Y n/a
16 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5812 3UTR 100% 10.800 5.400 Y SMIM11A n/a
17 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2750 3UTR 100% 5.625 2.813 Y KLHL30 n/a
18 TRCN0000157407 GATCTCGGCTTACTGCAACTT pLKO.1 7009 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
19 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 4432 3UTR 100% 2.640 1.320 Y LINC01098 n/a
20 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 2912 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
21 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2750 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371482.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01952 pDONR223 100% 93.2% 93.2% None 392_393ins90;1126_1131delGGTAAA n/a
2 ccsbBroad304_01952 pLX_304 0% 93.2% 93.2% V5 392_393ins90;1126_1131delGGTAAA n/a
3 TRCN0000465246 CTAGCATGTCGTGCTTTATCCATG pLX_317 22.7% 93.2% 93.2% V5 392_393ins90;1126_1131delGGTAAA n/a
4 ccsbBroadEn_14902 pDONR223 0% 93.2% 93.2% None 392_393ins90;1126_1131delGGTAAA n/a
5 ccsbBroad304_14902 pLX_304 0% 93.2% 93.2% V5 392_393ins90;1126_1131delGGTAAA n/a
6 TRCN0000488301 ATACTCCTTTGTCCGTGTTGTACT pLX_317 24.4% 93.2% 93.2% V5 (not translated due to prior stop codon) 392_393ins90;1126_1131delGGTAAA n/a
7 TRCN0000488288 TTTCCATTCCCTGTCAACTTAGGG pLX_317 27.1% 93.1% 93% V5 392_393ins90;1126_1131delGGTAAA;1329_1330insG n/a
Download CSV