Transcript: Human NM_001371496.1

Homo sapiens LIM zinc finger domain containing 1 (LIMS1), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
LIMS1 (3987)
Length:
4367
CDS:
80..1120

Additional Resources:

NCBI RefSeq record:
NM_001371496.1
NBCI Gene record:
LIMS1 (3987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365203 AGAAACTAGCTGAGACCTTAG pLKO_005 1089 CDS 100% 6.000 8.400 N LIMS1 n/a
2 TRCN0000365202 GTAAGAAGTGCTATGAGAAAT pLKO_005 1041 CDS 100% 13.200 9.240 N LIMS1 n/a
3 TRCN0000377540 TGCTATGAGAAATTTCCATTG pLKO_005 1049 CDS 100% 6.000 4.200 N LIMS1 n/a
4 TRCN0000059039 CCAGTCTGTAAGAAGTGCTAT pLKO.1 1034 CDS 100% 4.950 3.465 N LIMS1 n/a
5 TRCN0000059038 CCCTTATCCATTTGTTGACAT pLKO.1 1325 3UTR 100% 4.950 3.465 N LIMS1 n/a
6 TRCN0000365264 TTGACATGAAGCCAGTCTGTA pLKO_005 1023 CDS 100% 4.950 3.465 N LIMS1 n/a
7 TRCN0000071463 GCCAGTCTGTAAGAAGTGCTA pLKO.1 1033 CDS 100% 2.640 1.848 N Lims1 n/a
8 TRCN0000301715 GCCAGTCTGTAAGAAGTGCTA pLKO_005 1033 CDS 100% 2.640 1.848 N Lims1 n/a
9 TRCN0000071465 GAGAAGATCGTGAACAGTAAT pLKO.1 203 CDS 100% 13.200 7.920 N Lims1 n/a
10 TRCN0000301713 GAGAAGATCGTGAACAGTAAT pLKO_005 203 CDS 100% 13.200 7.920 N Lims1 n/a
11 TRCN0000370386 AGAATAAGTTTGTGGAGTTTG pLKO_005 1005 CDS 100% 10.800 6.480 N LIMS1 n/a
12 TRCN0000365263 TAACACTCAAGAATAAGTTTG pLKO_005 996 CDS 100% 10.800 6.480 N LIMS1 n/a
13 TRCN0000059040 GCTGAGACCTTAGGAAGGAAA pLKO.1 1097 CDS 100% 4.950 2.970 N LIMS1 n/a
14 TRCN0000059042 CGAGTTATCAAAGCCATGAAT pLKO.1 383 CDS 100% 5.625 2.813 Y LIMS1 n/a
15 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3185 3UTR 100% 4.950 2.475 Y CFLAR n/a
16 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3185 3UTR 100% 4.950 2.475 Y C19orf31 n/a
17 TRCN0000370331 CACTAAATTAACACTCAAGAA pLKO_005 988 CDS 100% 4.950 2.475 Y LIMS1 n/a
18 TRCN0000059041 CCCTGTCATAATCGTGAGAAA pLKO.1 500 CDS 100% 4.950 2.475 Y LIMS1 n/a
19 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3631 3UTR 100% 13.200 6.600 Y LIAS n/a
20 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3183 3UTR 100% 4.950 2.475 Y ERN2 n/a
21 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3183 3UTR 100% 4.950 2.475 Y P3H4 n/a
22 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3183 3UTR 100% 4.950 2.475 Y P3H4 n/a
23 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 3240 3UTR 100% 4.050 2.025 Y INTS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06524 pDONR223 100% 93.7% 93.3% None 1_63del;296T>C;848A>G n/a
2 ccsbBroad304_06524 pLX_304 0% 93.7% 93.3% V5 1_63del;296T>C;848A>G n/a
3 TRCN0000468941 TAGATCCTATTATCCCACTCTTGT pLX_317 39.8% 93.7% 93.3% V5 1_63del;296T>C;848A>G n/a
4 ccsbBroadEn_04624 pDONR223 100% 17.7% 14.2% None (many diffs) n/a
5 ccsbBroad304_04624 pLX_304 0% 17.7% 14.2% V5 (many diffs) n/a
6 TRCN0000469496 CCTGCACGGGACAGCCCGTCTAAT pLX_317 100% 17.7% 14.2% V5 (many diffs) n/a
Download CSV