Transcript: Human NM_001374178.1

Homo sapiens RAB5 interacting factor (RAB5IF), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
RAB5IF (55969)
Length:
1087
CDS:
174..539

Additional Resources:

NCBI RefSeq record:
NM_001374178.1
NBCI Gene record:
RAB5IF (55969)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001374178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155433 CAAAGTCTCCGTCTGGAGTAA pLKO.1 233 CDS 100% 4.950 6.930 N RAB5IF n/a
2 TRCN0000285287 CAAAGTCTCCGTCTGGAGTAA pLKO_005 233 CDS 100% 4.950 6.930 N RAB5IF n/a
3 TRCN0000183748 CCATCAAGTAACAGCTATTAT pLKO.1 828 3UTR 100% 15.000 7.500 Y RAB5IF n/a
4 TRCN0000275129 TTTACACTGCCATCCATTATG pLKO_005 556 3UTR 100% 13.200 6.600 Y RAB5IF n/a
5 TRCN0000285289 CAGGATTCTGCCTGATCAATG pLKO_005 388 CDS 100% 10.800 5.400 Y RAB5IF n/a
6 TRCN0000152019 CTTCAGCAATTACCTACAGAT pLKO.1 428 CDS 100% 4.950 2.475 Y RAB5IF n/a
7 TRCN0000275078 CTTCAGCAATTACCTACAGAT pLKO_005 428 CDS 100% 4.950 2.475 Y RAB5IF n/a
8 TRCN0000155232 GCACCTCTGGATTCAGATGAA pLKO.1 879 3UTR 100% 4.950 2.475 Y RAB5IF n/a
9 TRCN0000275128 GCACCTCTGGATTCAGATGAA pLKO_005 879 3UTR 100% 4.950 2.475 Y RAB5IF n/a
10 TRCN0000151946 CCATTTCTTCTTGGATACCAT pLKO.1 811 3UTR 100% 3.000 1.500 Y RAB5IF n/a
11 TRCN0000183593 GTACCTCTACTTCAGCAATTA pLKO.1 419 CDS 100% 0.000 0.000 Y RAB5IF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001374178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03688 pDONR223 100% 85.9% 85.4% None (many diffs) n/a
2 ccsbBroad304_03688 pLX_304 0% 85.9% 85.4% V5 (many diffs) n/a
3 TRCN0000466507 TTTCTGGTAGCCAAGGGACACTAG pLX_317 90.4% 85.9% 85.4% V5 (many diffs) n/a
4 ccsbBroadEn_15919 pDONR223 0% 65.4% 57.3% None (many diffs) n/a
5 ccsbBroad304_15919 pLX_304 0% 65.4% 57.3% V5 (many diffs) n/a
Download CSV