Transcript: Human NM_001374266.1

Homo sapiens peroxisome proliferator activated receptor gamma (PPARG), transcript variant 16, mRNA.

Source:
NCBI, updated 2019-09-17
Taxon:
Homo sapiens (human)
Gene:
PPARG (5468)
Length:
1241
CDS:
142..828

Additional Resources:

NCBI RefSeq record:
NM_001374266.1
NBCI Gene record:
PPARG (5468)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001374266.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355862 TCCGTGGATCTCTCCGTAATG pLKO_005 196 CDS 100% 10.800 15.120 N PPARG n/a
2 TRCN0000001673 CAGCATTTCTACTCCACATTA pLKO.1 270 CDS 100% 13.200 9.240 N PPARG n/a
3 TRCN0000001670 GCCAACATTTCCCTTCTTCCA pLKO.1 1062 3UTR 100% 2.640 1.848 N PPARG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001374266.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroad304_01249 pLX_304 45.7% 46.4% 72.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_01249 pDONR223 100% 46.3% 46.3% None (many diffs) n/a
3 TRCN0000481296 GTATAACGCCGGAGATCCACGACA pLX_317 29.5% 46.3% 46.3% V5 (many diffs) n/a
4 TRCN0000488857 GGCTGTCCTGGAAACAGACATATG pLX_317 25.8% 45.8% 45.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488879 GCAATGGCGCTCTCAGACGTAGTC pLX_317 20.4% 43.8% 43.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489541 AAAGCGGGAAGACGTATTGCCAGG pLX_317 22.5% 43.8% 43.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV