Transcript: Human NM_001374438.1

Homo sapiens dymeclin (DYM), transcript variant 19, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DYM (54808)
Length:
9793
CDS:
302..2125

Additional Resources:

NCBI RefSeq record:
NM_001374438.1
NBCI Gene record:
DYM (54808)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001374438.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434735 ACGGGTCCTGGAAATCATTAA pLKO_005 1918 CDS 100% 13.200 18.480 N DYM n/a
2 TRCN0000154130 CCATGTGTATATGGCCCTTAT pLKO.1 1474 CDS 100% 10.800 15.120 N DYM n/a
3 TRCN0000425306 ACAGGTTACTTGGTGTATCTT pLKO_005 2208 3UTR 100% 5.625 7.875 N DYM n/a
4 TRCN0000427655 AGAGGATTGCACGAGTGTGTT pLKO_005 2236 3UTR 100% 4.950 6.930 N DYM n/a
5 TRCN0000151782 CATGTGTATATGGCCCTTATA pLKO.1 1475 CDS 100% 13.200 10.560 N DYM n/a
6 TRCN0000419561 AGAGGTTCGCTGAGTTCTAAT pLKO_005 1820 CDS 100% 13.200 9.240 N DYM n/a
7 TRCN0000432400 GTTTGGCAGCTTTAGCAAATA pLKO_005 1686 CDS 100% 13.200 9.240 N DYM n/a
8 TRCN0000429540 TATTCCACTCTTAGATATTAC pLKO_005 784 CDS 100% 13.200 9.240 N DYM n/a
9 TRCN0000424342 TGGAATCAGCTTCTCTCATTT pLKO_005 398 CDS 100% 13.200 9.240 N DYM n/a
10 TRCN0000152800 GCAGACACACAATGCTTTGTT pLKO.1 604 CDS 100% 5.625 3.938 N DYM n/a
11 TRCN0000153544 CAGACAGGTTACTTGGTGTAT pLKO.1 2205 3UTR 100% 4.950 3.465 N DYM n/a
12 TRCN0000151304 GCACTAATTAAGGTCTTCCTT pLKO.1 527 CDS 100% 3.000 2.100 N DYM n/a
13 TRCN0000153926 CAGAAGTAGACAGACAGGTTA pLKO.1 2195 3UTR 100% 4.950 2.970 N DYM n/a
14 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 9066 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
15 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 9444 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001374438.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08410 pDONR223 100% 90.6% 90.4% None 763_764insCAG;1219G>T;1560_1561ins183 n/a
2 ccsbBroad304_08410 pLX_304 0% 90.6% 90.4% V5 763_764insCAG;1219G>T;1560_1561ins183 n/a
3 TRCN0000475275 GAATCTTAACCAGAACTAATTATC pLX_317 23% 90.6% 90.4% V5 763_764insCAG;1219G>T;1560_1561ins183 n/a
Download CSV