Transcript: Human NM_001695.5

Homo sapiens ATPase H+ transporting V1 subunit C1 (ATP6V1C1), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
ATP6V1C1 (528)
Length:
5635
CDS:
183..1331

Additional Resources:

NCBI RefSeq record:
NM_001695.5
NBCI Gene record:
ATP6V1C1 (528)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001695.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029567 CGGCAACTTCAAAGAACAATA pLKO.1 253 CDS 100% 13.200 18.480 N ATP6V1C1 n/a
2 TRCN0000319279 CGGCAACTTCAAAGAACAATA pLKO_005 253 CDS 100% 13.200 18.480 N ATP6V1C1 n/a
3 TRCN0000101629 TCTGCATACAATAACCTGAAA pLKO.1 603 CDS 100% 4.950 6.930 N Atp6v1c1 n/a
4 TRCN0000323685 TCTGCATACAATAACCTGAAA pLKO_005 603 CDS 100% 4.950 6.930 N Atp6v1c1 n/a
5 TRCN0000029568 CAATGCTACTTCAGCCCAATA pLKO.1 1135 CDS 100% 10.800 7.560 N ATP6V1C1 n/a
6 TRCN0000319352 CAATGCTACTTCAGCCCAATA pLKO_005 1135 CDS 100% 10.800 7.560 N ATP6V1C1 n/a
7 TRCN0000029564 CCCTATGTGTACTACAAGATT pLKO.1 1284 CDS 100% 5.625 3.938 N ATP6V1C1 n/a
8 TRCN0000319281 CCCTATGTGTACTACAAGATT pLKO_005 1284 CDS 100% 5.625 3.938 N ATP6V1C1 n/a
9 TRCN0000029566 CCAAGACAGTTACCTGTGTAA pLKO.1 839 CDS 100% 4.950 3.465 N ATP6V1C1 n/a
10 TRCN0000319280 CCAAGACAGTTACCTGTGTAA pLKO_005 839 CDS 100% 4.950 3.465 N ATP6V1C1 n/a
11 TRCN0000029565 GCTCAATACATGGCTGATGTA pLKO.1 399 CDS 100% 0.495 0.347 N ATP6V1C1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001695.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487910 TGCAACTAGCCACCCCACGCAAGG pLX_317 26.8% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000488949 TGGCGGGTCCATAGGTCCTAGTAC pLX_317 28% 99.9% 99.7% V5 1146_1147insG n/a
3 ccsbBroadEn_00136 pDONR223 100% 99.9% 99.7% None 1146delG n/a
4 ccsbBroad304_00136 pLX_304 0% 99.9% 99.7% V5 (not translated due to frame shift) 1146delG n/a
5 TRCN0000472527 CCCAACTCTGTCTATTAACAGCGC pLX_317 40.5% 99.9% 99.7% V5 (not translated due to frame shift) 1146delG n/a
Download CSV