Transcript: Human NM_002643.4

Homo sapiens phosphatidylinositol glycan anchor biosynthesis class F (PIGF), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
PIGF (5281)
Length:
1294
CDS:
94..753

Additional Resources:

NCBI RefSeq record:
NM_002643.4
NBCI Gene record:
PIGF (5281)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002643.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077130 CCTATTCCACTGGATTGGGAA pLKO.1 607 CDS 100% 2.640 3.696 N Pigf n/a
2 TRCN0000151053 GAGTTGGCATTGGAAACATTT pLKO.1 412 CDS 100% 13.200 9.240 N PIGF n/a
3 TRCN0000338556 GAGTTGGCATTGGAAACATTT pLKO_005 412 CDS 100% 13.200 9.240 N PIGF n/a
4 TRCN0000154221 CAAAGCCAAGCAGTTCCATTT pLKO.1 818 3UTR 100% 10.800 7.560 N PIGF n/a
5 TRCN0000350985 CAAAGCCAAGCAGTTCCATTT pLKO_005 818 3UTR 100% 10.800 7.560 N PIGF n/a
6 TRCN0000151825 CTTCTTGGAGAACTTCTCAAT pLKO.1 180 CDS 100% 4.950 3.465 N PIGF n/a
7 TRCN0000338555 CTTCTTGGAGAACTTCTCAAT pLKO_005 180 CDS 100% 4.950 3.465 N PIGF n/a
8 TRCN0000153818 CAAACCTCAAAGCATGGCTAA pLKO.1 491 CDS 100% 4.050 2.835 N PIGF n/a
9 TRCN0000157478 GCATGGCTAAGAGTGTTCAGT pLKO.1 502 CDS 100% 3.000 2.100 N PIGF n/a
10 TRCN0000338616 GCATGGCTAAGAGTGTTCAGT pLKO_005 502 CDS 100% 3.000 2.100 N PIGF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002643.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01199 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01199 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475035 TCGCCCCCATTTTCCGGGCAACCG pLX_317 12.7% 100% 100% V5 n/a
4 ccsbBroadEn_06726 pDONR223 100% 85.5% 81.3% None (many diffs) n/a
5 ccsbBroad304_06726 pLX_304 0% 85.5% 81.3% V5 (many diffs) n/a
6 TRCN0000478448 AATATGCTTTTCCAGCTTGTATGA pLX_317 50% 85.5% 81.3% V5 (many diffs) n/a
Download CSV