Transcript: Human NM_002755.3

Homo sapiens mitogen-activated protein kinase kinase 1 (MAP2K1), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
MAP2K1 (5604)
Length:
2603
CDS:
476..1657

Additional Resources:

NCBI RefSeq record:
NM_002755.3
NBCI Gene record:
MAP2K1 (5604)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145794 CATCCTAGTCAACTCCCGTG pXPR_003 GGG 601 51% 6 1.2012 MAP2K1 MAP2K1 76210
2 BRDN0001146127 GGGCACAAGGTCCTACATGT pXPR_003 CGG 688 58% 6 0.996 MAP2K1 MAP2K1 76213
3 BRDN0001147218 TATGGTGCGTTCTACAGCGA pXPR_003 TGG 404 34% 3 0.9095 MAP2K1 MAP2K1 76212
4 BRDN0001147078 GCAGCAGCGAAAGCGCCTTG pXPR_003 AGG 148 13% 2 -0.0121 MAP2K1 MAP2K1 76211
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002755.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199799 GTCCTACATGTCGCCAGAAAG pLKO.1 1156 CDS 100% 10.800 15.120 N MAP2K1 n/a
2 TRCN0000344506 GTCCTACATGTCGCCAGAAAG pLKO_005 1156 CDS 100% 10.800 15.120 N MAP2K1 n/a
3 TRCN0000002329 GCTTCTATGGTGCGTTCTACA pLKO.1 858 CDS 100% 4.950 6.930 N MAP2K1 n/a
4 TRCN0000344571 GCTTCTATGGTGCGTTCTACA pLKO_005 858 CDS 100% 4.950 6.930 N MAP2K1 n/a
5 TRCN0000002332 GATTACATAGTCAACGAGCCT pLKO.1 1418 CDS 100% 0.660 0.924 N MAP2K1 n/a
6 TRCN0000219684 AGTTAGCATTGCTGTAATAAA pLKO.1 979 CDS 100% 15.000 10.500 N MAP2K1 n/a
7 TRCN0000332972 AGTTAGCATTGCTGTAATAAA pLKO_005 979 CDS 100% 15.000 10.500 N MAP2K1 n/a
8 TRCN0000199961 CTGGAGATCAAACCCGCAATC pLKO.1 776 CDS 100% 6.000 4.200 N MAP2K1 n/a
9 TRCN0000002330 CTGATGCTGAGGAAGTGGATT pLKO.1 1566 CDS 100% 4.950 3.465 N MAP2K1 n/a
10 TRCN0000002331 GAGGGAGAAGCACAAGATCAT pLKO.1 1015 CDS 100% 4.950 3.465 N MAP2K1 n/a
11 TRCN0000195621 CCCATATCCAAGTACCAATGC pLKO.1 2433 3UTR 100% 4.050 2.835 N MAP2K1 n/a
12 TRCN0000219683 GTCATGGCCAGAAAGCTAATT pLKO.1 752 CDS 100% 13.200 7.920 N MAP2K1 n/a
13 TRCN0000219685 TTGACATTTGGTGGTACTTTA pLKO.1 2023 3UTR 100% 13.200 7.920 N MAP2K1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002755.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroad304_14807 pLX_304 50.7% 99.9% 36.3% V5 (not translated due to prior stop codon) 413_414insG n/a
2 ccsbBroadEn_14807 pDONR223 100% 99.8% 36.3% None 413_414insG;603_604insG n/a
3 TRCN0000492332 GTGTTATTTGGCCTAAGAGCTCAC pLX_317 33.1% 99.9% 99.7% V5 1179_1180insG n/a
4 ccsbBroadEn_16176 pDONR223 0% 99.6% 99.4% None 652_653delTCinsGA;664_665delTCinsGA n/a
5 ccsbBroad304_16176 pLX_304 0% 99.6% 99.4% V5 652_653delTCinsGA;664_665delTCinsGA n/a
Download CSV