Transcript: Human NM_002908.4

Homo sapiens REL proto-oncogene, NF-kB subunit (REL), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
REL (5966)
Length:
11204
CDS:
268..2127

Additional Resources:

NCBI RefSeq record:
NM_002908.4
NBCI Gene record:
REL (5966)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002908.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428686 ACAACAATGCCGATGACATAG pLKO_005 1655 CDS 100% 10.800 15.120 N REL n/a
2 TRCN0000420389 GTATGTCAGCAGGCGCCAATT pLKO_005 1895 CDS 100% 10.800 15.120 N REL n/a
3 TRCN0000412297 GTGCCAGGATCACGTAGAAAC pLKO_005 1176 CDS 100% 10.800 15.120 N REL n/a
4 TRCN0000416491 GACCATCAAACAGTACTAATC pLKO_005 2003 CDS 100% 10.800 8.640 N REL n/a
5 TRCN0000039983 CCACCTATATAGATGCAGCAT pLKO.1 2161 3UTR 100% 2.640 2.112 N REL n/a
6 TRCN0000039987 GCAGATAACAGCATGATAAAT pLKO.1 1975 CDS 100% 15.000 10.500 N REL n/a
7 TRCN0000430620 AGCAGATTTATATGGTATTTC pLKO_005 1704 CDS 100% 13.200 9.240 N REL n/a
8 TRCN0000435450 CATACCCTTCTATCCAGATTA pLKO_005 404 CDS 100% 13.200 9.240 N REL n/a
9 TRCN0000433863 AGTGAGAATTACATTAGTAAC pLKO_005 447 CDS 100% 10.800 7.560 N REL n/a
10 TRCN0000424900 ATAGTCAGTATTCAGGTATTG pLKO_005 2048 CDS 100% 10.800 7.560 N REL n/a
11 TRCN0000435698 CAACTTTGGACATAGCGAATA pLKO_005 2298 3UTR 100% 10.800 7.560 N REL n/a
12 TRCN0000039986 CCAGGAAGTTAGTGAATCTAT pLKO.1 1071 CDS 100% 5.625 3.938 N REL n/a
13 TRCN0000039984 GCAGGAATCAATCCATTCAAT pLKO.1 640 CDS 100% 5.625 3.938 N REL n/a
14 TRCN0000414851 CTGACTGAGAATATAATACTG pLKO_005 2236 3UTR 100% 4.950 3.465 N REL n/a
15 TRCN0000010421 CTTCAGTTGTGCAGATAACAG pLKO.1 1965 CDS 100% 4.950 3.465 N REL n/a
16 TRCN0000039985 GCTGTCTAATTGTTCTGTGAA pLKO.1 1737 CDS 100% 4.950 3.465 N REL n/a
17 TRCN0000010420 GAAGATTGTGACCTCAATGTG pLKO.1 688 CDS 100% 4.950 2.970 N REL n/a
18 TRCN0000151984 CCAGTTAGAATGGCAATCATT pLKO.1 8726 3UTR 100% 5.625 2.813 Y LOC340211 n/a
19 TRCN0000134155 CCTTCCTTACACCTTATACAA pLKO.1 8236 3UTR 100% 5.625 2.813 Y FSIP2 n/a
20 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 7647 3UTR 100% 4.950 2.475 Y ERAP2 n/a
21 TRCN0000156019 CATGGAATACTATGCAGCCAT pLKO.1 9064 3UTR 100% 2.640 1.320 Y LOC340211 n/a
22 TRCN0000157513 GCCAAGTCAATCCTAAGCCAA pLKO.1 7953 3UTR 100% 2.640 1.320 Y LOC340211 n/a
23 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7648 3UTR 100% 13.200 6.600 Y LIAS n/a
24 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1265 CDS 100% 5.625 2.813 Y KLHL30 n/a
25 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1265 CDS 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002908.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11094 pDONR223 100% 94.8% 94.8% None 922_1017del n/a
2 ccsbBroad304_11094 pLX_304 0% 94.8% 94.8% V5 922_1017del n/a
3 TRCN0000481578 CGCACCACACATAGACTCAAGCCC pLX_317 25.6% 94.8% 94.8% V5 922_1017del n/a
Download CSV