Transcript: Human NM_003034.3

Homo sapiens ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1 (ST8SIA1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
ST8SIA1 (6489)
Length:
9737
CDS:
483..1553

Additional Resources:

NCBI RefSeq record:
NM_003034.3
NBCI Gene record:
ST8SIA1 (6489)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003034.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036046 GCCGTCAAATAGATGAAGCAA pLKO.1 940 CDS 100% 3.000 4.200 N ST8SIA1 n/a
2 TRCN0000417839 AGCCATCTTTGAGGGTTTATT pLKO_005 1171 CDS 100% 15.000 10.500 N ST8SIA1 n/a
3 TRCN0000435371 CAACACAAACTGGCTTAATAA pLKO_005 1932 3UTR 100% 15.000 10.500 N ST8SIA1 n/a
4 TRCN0000417447 GTTGGCTTGGAGGACAAATAA pLKO_005 1710 3UTR 100% 15.000 10.500 N ST8SIA1 n/a
5 TRCN0000036048 CCCTCCTTTGTCAAGTGAATA pLKO.1 983 CDS 100% 13.200 9.240 N ST8SIA1 n/a
6 TRCN0000036044 CCCAACTTTCTGCGTAGCATT pLKO.1 1239 CDS 100% 4.950 3.465 N ST8SIA1 n/a
7 TRCN0000036045 CCCATCTCTTTGCTATGACTA pLKO.1 748 CDS 100% 4.950 3.465 N ST8SIA1 n/a
8 TRCN0000036047 GCCAATCAAACAGTGCTGTTT pLKO.1 1212 CDS 100% 0.495 0.347 N ST8SIA1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 8161 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 8161 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003034.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01535 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01535 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472723 GACAGCTCCACAAACTATTGCCTG pLX_317 31.8% 100% 100% V5 n/a
4 ccsbBroadEn_15590 pDONR223 0% 22.8% 22.4% None (many diffs) n/a
5 ccsbBroad304_15590 pLX_304 0% 22.8% 22.4% V5 (many diffs) n/a
6 TRCN0000467438 CTCGGGGCGCTAGTGCCGCCAATA pLX_317 100% 22.8% 22.4% V5 (many diffs) n/a
Download CSV