Transcript: Human NM_003786.4

Homo sapiens ATP binding cassette subfamily C member 3 (ABCC3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ABCC3 (8714)
Length:
5693
CDS:
57..4640

Additional Resources:

NCBI RefSeq record:
NM_003786.4
NBCI Gene record:
ABCC3 (8714)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003786.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059403 CGCTGATCTTACAACACTATT pLKO.1 1147 CDS 100% 13.200 18.480 N ABCC3 n/a
2 TRCN0000428274 ACCAAATATGTCCGCAGAATG pLKO_005 4699 3UTR 100% 10.800 15.120 N ABCC3 n/a
3 TRCN0000059407 CGCAAAGAATGTCGACCCTAA pLKO.1 650 CDS 100% 4.050 5.670 N ABCC3 n/a
4 TRCN0000059404 CCGGAATTATTCTGTGCGCTA pLKO.1 3929 CDS 100% 2.160 3.024 N ABCC3 n/a
5 TRCN0000413253 GATACGAATGATGTCAGATTT pLKO_005 3785 CDS 100% 13.200 9.240 N ABCC3 n/a
6 TRCN0000419743 GTGCTCTTTGCTGCACTATTT pLKO_005 3675 CDS 100% 13.200 9.240 N ABCC3 n/a
7 TRCN0000413135 GAGATCATCAGTGATACTAAG pLKO_005 3567 CDS 100% 10.800 7.560 N ABCC3 n/a
8 TRCN0000059406 GCACTGCTGCACAACAAGATA pLKO.1 3195 CDS 100% 5.625 3.938 N ABCC3 n/a
9 TRCN0000059405 GCAGGTGACATTTGCTCTGAA pLKO.1 3758 CDS 100% 4.950 3.465 N ABCC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003786.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01998 pDONR223 100% 100% 100% None n/a
2 TRCN0000489457 TCATAAGGGAATTAGTTATCCGGC pLX_317 7.1% 100% 100% V5 (not translated due to prior stop codon) n/a
3 TRCN0000491674 TAACCTACCTTCTGGATACAGATC pLX_317 6.8% 99.9% 99.9% V5 4581_4582insG n/a
Download CSV