Transcript: Human NM_003807.4

Homo sapiens TNF superfamily member 14 (TNFSF14), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
TNFSF14 (8740)
Length:
4807
CDS:
383..1105

Additional Resources:

NCBI RefSeq record:
NM_003807.4
NBCI Gene record:
TNFSF14 (8740)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003807.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436863 GACAGACCGACATCCCATTCA pLKO_005 426 CDS 100% 4.950 6.930 N TNFSF14 n/a
2 TRCN0000058739 GCGAAGGTCTCACGAGGTCAA pLKO.1 640 CDS 100% 1.350 1.890 N TNFSF14 n/a
3 TRCN0000058738 GCGTGATGGTACCCGGTCTTA pLKO.1 1063 CDS 100% 0.000 0.000 N TNFSF14 n/a
4 TRCN0000058740 GCTACTACTACATCTACTCCA pLKO.1 798 CDS 100% 2.640 2.112 N TNFSF14 n/a
5 TRCN0000417207 TCCTGGGAGCAGCTGATACAA pLKO_005 617 CDS 100% 5.625 3.938 N TNFSF14 n/a
6 TRCN0000419467 ATGGGTCTGACACGTGGAGAA pLKO_005 1130 3UTR 100% 4.050 2.835 N TNFSF14 n/a
7 TRCN0000417834 GGCTTTCATGGTGTGAAGGAA pLKO_005 1090 CDS 100% 3.000 2.100 N TNFSF14 n/a
8 TRCN0000058741 GCCGCTGTTATGGGAGACTCA pLKO.1 712 CDS 100% 0.880 0.616 N TNFSF14 n/a
9 TRCN0000058742 GTGCTGGATGAACGCCTGGTT pLKO.1 1037 CDS 100% 0.880 0.616 N TNFSF14 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1211 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000413974 TGCCTGCCTGTAATCCAGCTA pLKO_005 1342 3UTR 100% 2.640 1.320 Y TNFSF14 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1212 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003807.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491434 ACAATTTGACCGCTCTACCGATCA pLX_317 40.4% 99.8% 99.5% V5 (not translated due to prior stop codon) 640A>G n/a
2 TRCN0000489140 CTTCGCGGCGATATCCGATCTAAG pLX_317 56.1% 84.8% 84.5% V5 (not translated due to prior stop codon) 112_219del;640A>G n/a
3 ccsbBroadEn_11300 pDONR223 100% 73.6% 73.3% None 358C>G;532_720del n/a
4 ccsbBroad304_11300 pLX_304 0% 73.6% 73.3% V5 358C>G;532_720del n/a
5 TRCN0000478814 ACTTCCCACGAAGTGAAATAATCT pLX_317 67.1% 73.6% 73.3% V5 358C>G;532_720del n/a
Download CSV