Transcript: Human NM_003889.3

Homo sapiens nuclear receptor subfamily 1 group I member 2 (NR1I2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NR1I2 (8856)
Length:
4446
CDS:
1840..3144

Additional Resources:

NCBI RefSeq record:
NM_003889.3
NBCI Gene record:
NR1I2 (8856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021620 CGAGCTGTGTCAACTGAGATT pLKO.1 2682 CDS 100% 4.950 3.960 N NR1I2 n/a
2 TRCN0000021623 CACTACCTTCTCCCATTTCAA pLKO.1 2328 CDS 100% 5.625 3.938 N NR1I2 n/a
3 TRCN0000021619 GCCTTGATCAAGCGGAAGAAA pLKO.1 2206 CDS 100% 5.625 3.938 N NR1I2 n/a
4 TRCN0000021622 CATGCTGAAATTCCACTACAT pLKO.1 2805 CDS 100% 4.950 3.465 N NR1I2 n/a
5 TRCN0000021621 CGGCATGAAGAAGGAGATGAT pLKO.1 2154 CDS 100% 4.950 3.465 N NR1I2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11312 pDONR223 100% 87% 87% None 1_165del;519_521delGCT n/a
2 ccsbBroad304_11312 pLX_304 0% 87% 87% V5 1_165del;519_521delGCT n/a
3 TRCN0000466920 CTTACGAAGTAAATTCTCACCAAT pLX_317 36% 87% 87% V5 1_165del;519_521delGCT n/a
4 TRCN0000488621 GTTCGACACCAGCTCGGATCGACC pLX_317 23.3% 87% 86.8% V5 1_165del;519_521delGCT;1302_1303insG n/a
Download CSV