Transcript: Human NM_004138.4

Homo sapiens keratin 33A (KRT33A), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KRT33A (3883)
Length:
1303
CDS:
62..1276

Additional Resources:

NCBI RefSeq record:
NM_004138.4
NBCI Gene record:
KRT33A (3883)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004138.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420943 CAACCAATGCATGTGACAAGT pLKO_005 1182 CDS 100% 4.950 3.465 N KRT33A n/a
2 TRCN0000116973 AGATGACTTCAGGACCAAATA pLKO.1 475 CDS 100% 13.200 7.920 N KRT33A n/a
3 TRCN0000421313 GAACCATGAGCAGGAGGTTAA pLKO_005 637 CDS 100% 10.800 6.480 N KRT33A n/a
4 TRCN0000116974 CTCCTTCAATGGCAGTGAGAA pLKO.1 211 CDS 100% 4.950 2.970 N KRT33A n/a
5 TRCN0000116972 CAGATGACTTCAGGACCAAAT pLKO.1 474 CDS 100% 10.800 5.400 Y KRT33A n/a
6 TRCN0000116976 CTGTGCAGCAAGTCTGAGAAT pLKO.1 413 CDS 100% 4.950 2.475 Y KRT33A n/a
7 TRCN0000116689 CCAGTCCTACTTCAAGACCAT pLKO.1 370 CDS 100% 2.640 1.320 Y KRT33B n/a
8 TRCN0000116975 GCGGCTGGAGTGTGAGATCAA pLKO.1 1102 CDS 100% 1.650 0.825 Y KRT33A n/a
9 TRCN0000089569 CAGAAGATCCTGTGCAGCAAA pLKO.1 404 CDS 100% 4.950 2.475 Y Krt31 n/a
10 TRCN0000433521 AGACCGAGGAGCTGAACAAAG pLKO_005 810 CDS 100% 10.800 5.400 Y KRT16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004138.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00921 pDONR223 100% 95.3% 93.8% None (many diffs) n/a
2 ccsbBroad304_00921 pLX_304 0% 95.3% 93.8% V5 (many diffs) n/a
3 ccsbBroadEn_00920 pDONR223 100% 90% 90.8% None (many diffs) n/a
4 ccsbBroad304_00920 pLX_304 0% 90% 90.8% V5 (many diffs) n/a
5 TRCN0000467714 ATTAGCGGGGACGAAACGTTTAGA pLX_317 35% 90% 90.8% V5 (many diffs) n/a
6 ccsbBroadEn_06510 pDONR223 100% 79.8% 79.8% None (many diffs) n/a
7 ccsbBroad304_06510 pLX_304 0% 79.8% 79.8% V5 (many diffs) n/a
8 TRCN0000477279 GGCACAGACCCCCTATCAGTTGAG pLX_317 24% 79.8% 79.8% V5 (many diffs) n/a
Download CSV